ID: 1185208382

View in Genome Browser
Species Human (GRCh38)
Location 22:49553196-49553218
Sequence TGCCCACAGGGCTGTGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185208382_1185208392 -8 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208392 22:49553211-49553233 TGTGGGCAGGGAGGGGAGGAGGG 0: 1
1: 4
2: 31
3: 305
4: 2578
1185208382_1185208394 17 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208394 22:49553236-49553258 CAGCCCCCACACAGGCCGCCTGG 0: 1
1: 0
2: 9
3: 29
4: 336
1185208382_1185208399 24 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208399 22:49553243-49553265 CACACAGGCCGCCTGGCACCAGG 0: 1
1: 0
2: 6
3: 36
4: 282
1185208382_1185208393 9 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208393 22:49553228-49553250 GGAGGGCTCAGCCCCCACACAGG 0: 1
1: 1
2: 6
3: 26
4: 424
1185208382_1185208391 -9 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG 0: 1
1: 2
2: 24
3: 289
4: 2030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185208382 Original CRISPR TGCCCACAGGGCTGTGCCCG AGG (reversed) Intronic
901072199 1:6526663-6526685 TCCTTCCAGGGCTGTGCCCGGGG + Intronic
901142325 1:7043148-7043170 TGCCCAGAGGCCTGTGCCAGCGG - Intronic
901754439 1:11432805-11432827 TGCTCACATGGCTGTCCCCTCGG + Intergenic
901841717 1:11957951-11957973 TGCGCCCAGGCCTGTGCCTGAGG + Intronic
903093859 1:20950072-20950094 AAACCACAGGGCTGTGCTCGGGG + Exonic
903219990 1:21864200-21864222 TGCCCCTAGGACTGTGCCCCCGG - Exonic
903462299 1:23528429-23528451 TGCCCACGGGGCTGGGCCCCGGG + Intronic
904038045 1:27569114-27569136 TGTCCCCAGGGCTGTGCACTGGG - Intronic
904078651 1:27858340-27858362 TCCTCTCAGGGCTGTGCCCGGGG - Intergenic
904475493 1:30762198-30762220 AGCCCACAGGCCTGTGGCCTGGG + Intergenic
905217768 1:36421492-36421514 TGCACAAAGTGCTGTGCCAGAGG - Intronic
905297165 1:36961542-36961564 CTCCCCCAGGGCTGTGCCTGGGG - Intronic
905446620 1:38031700-38031722 TGCCCAGAGGGCAGTTCCTGGGG - Intergenic
907317138 1:53579692-53579714 TGCCCCCATGGCTGCCCCCGCGG - Intronic
915070044 1:153259367-153259389 TGACCACAGGGCTGTGCTTGAGG - Intergenic
918497492 1:185156788-185156810 TGCCCACAGGGCTGGATCCAAGG + Exonic
919877324 1:201879410-201879432 TTCCCCCAGGGCTGTGTCCTTGG + Exonic
920745880 1:208627995-208628017 TGACCACAGGACTGTGCTGGAGG - Intergenic
922459338 1:225803067-225803089 TGCCCACTAAGCTGTGCCCCAGG + Intergenic
922480598 1:225937861-225937883 TGCCCACTAAGCTGTGCCCCAGG - Intronic
924384818 1:243490847-243490869 TGCCCACAGGGCTGGGTTCTGGG - Intronic
924501436 1:244642486-244642508 CGCCCTCAGGCCTGTGCCCACGG + Intergenic
1062855864 10:779306-779328 TGCCCACAGGCCTGTGTGGGAGG - Intergenic
1063369967 10:5514797-5514819 TTCACACAGGGCTGTGTCCCGGG - Intergenic
1064851594 10:19714576-19714598 TACCCCCAGGACTGTGCCCACGG - Intronic
1065288058 10:24203943-24203965 TGGCCACAGTGCTGTGCACACGG + Intronic
1065963756 10:30754469-30754491 TGTGCACAGGGCTCTGCCCACGG + Intergenic
1067079434 10:43204890-43204912 TGCCCACAGGGCAGAGCCAGGGG - Intronic
1067177499 10:43960320-43960342 AGCCCCCAGGCCTGTGCACGAGG - Intergenic
1067274556 10:44822103-44822125 TTCCCACAGGGCTGCCCCCAGGG + Intergenic
1067284112 10:44894971-44894993 TGGGCACAGCGCTGGGCCCGCGG - Intergenic
1070792316 10:79196761-79196783 GGCCCACCGGGCTCTGCCCCCGG + Intronic
1073468724 10:103709554-103709576 TGCCGAAGGGGCTGTGCCAGAGG - Intronic
1074178015 10:111030337-111030359 TACCCTCGGGCCTGTGCCCGTGG - Intergenic
1074801606 10:117005651-117005673 TGCCCACAGGGGCGGGCCCAGGG + Intronic
1075430440 10:122375266-122375288 TCCCTCCAGGGCTGTGCCCGCGG + Intronic
1076383676 10:130042134-130042156 AGCCCACAGAGCTCTGCCTGGGG - Intergenic
1076778921 10:132713452-132713474 TCCCCACAGGGCTCTGCACAAGG + Intronic
1076880192 10:133236200-133236222 TGGCCACAGGGCTGGCCCCGAGG - Intergenic
1076887416 10:133269053-133269075 TGCCCACAGCACTGTGGCCCAGG - Intronic
1077360236 11:2137577-2137599 TGCCCACTGGGCAGGGGCCGCGG + Intronic
1077369172 11:2173578-2173600 TGCCCCCAGGGATGTTCCAGAGG - Intergenic
1078355722 11:10630114-10630136 TGGCCACGGGGTTGTGGCCGTGG - Intronic
1078820045 11:14869696-14869718 AGCCCAGAGGGTTGTGCCCAGGG + Exonic
1078929671 11:15903473-15903495 TGCCTACAGGGCACTGCCCAGGG + Intergenic
1081691511 11:45081358-45081380 CTCCCACAGGGCTGTCCCAGGGG - Intergenic
1081695921 11:45109051-45109073 TGCCCAGAGGCCTGTGGCCAGGG - Intronic
1081856614 11:46308067-46308089 TGCCCAAAGCCCTGTGCCCTGGG + Intronic
1084035038 11:66504544-66504566 TGTCCACAGGGCTCTGCCATAGG - Intronic
1085851360 11:80124246-80124268 TGGGCCCAGGGCTGTGCCTGAGG + Intergenic
1091787984 12:3254436-3254458 TGCCCACAGGCCTGACCCAGGGG - Intronic
1091936183 12:4436044-4436066 TGGCTACTGGGCTGTGCCAGAGG + Intronic
1101707954 12:107238119-107238141 CGCCCACAGGGATGGGCCCCAGG - Intergenic
1101717614 12:107324318-107324340 TGGCCACAGGGCTGTGCCCATGG - Intronic
1103443190 12:120978615-120978637 TGCCCACAGGGCTTGGCTAGTGG + Exonic
1104358019 12:128105707-128105729 TGCCCACGGGGATGCGCCCACGG + Intergenic
1105591696 13:21798406-21798428 TGCTCACAAGGCTGAGCCCAGGG + Intergenic
1106135115 13:26968026-26968048 TGCCCCCAGCTCTGAGCCCGTGG + Intergenic
1112605790 13:100904511-100904533 TTCCCACAGGCCTGTGCACTGGG - Intergenic
1113840107 13:113354316-113354338 TGTCCACGGGGCTGAGCCAGTGG - Intronic
1113964263 13:114143871-114143893 TGCACACAGGTCTGTGGCGGAGG + Intergenic
1114658264 14:24329078-24329100 TGGACACAGGGCTGTCTCCGTGG + Exonic
1116422176 14:44745329-44745351 TCCCCACAGGGCTGTGGTGGTGG + Intergenic
1117519132 14:56532622-56532644 TGCCCACAGGTATCTGCCCAAGG - Intronic
1118860653 14:69660405-69660427 GGCCCCCTGGGCTGTGCCAGGGG - Intronic
1121114237 14:91332246-91332268 TGCCCTCAGGGCTGTGTGGGAGG - Intronic
1122420261 14:101571944-101571966 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420267 14:101571983-101572005 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420280 14:101572061-101572083 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420286 14:101572100-101572122 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420292 14:101572139-101572161 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420304 14:101572217-101572239 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420310 14:101572256-101572278 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420316 14:101572295-101572317 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420322 14:101572334-101572356 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420328 14:101572373-101572395 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420334 14:101572412-101572434 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420340 14:101572451-101572473 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1122420363 14:101572607-101572629 TGCCCTCACTGCTGTGCACGTGG - Intergenic
1125726551 15:41871240-41871262 TGCCCACGGGGCTCTGCAGGGGG - Intronic
1128527951 15:68425189-68425211 TGCTCACATGGCTCTCCCCGTGG - Intronic
1131248946 15:90818599-90818621 TGCCCAGAGGCCTCTGCCAGCGG - Intergenic
1131464434 15:92644281-92644303 AGCTCAGAGGGCTGTGCCCAGGG - Intronic
1132568368 16:633449-633471 TGCCAGCAGGCCTGTGCCCGCGG + Exonic
1132570553 16:642200-642222 TGCGCAAAGGGCTGCGCCCGCGG - Exonic
1132975286 16:2708034-2708056 TGCCCACAGGGCTTGCCGCGTGG + Exonic
1134353168 16:13456945-13456967 TGCCCACAGGCCTATTCCCTTGG + Intergenic
1134803939 16:17108863-17108885 TCCCTCCAGCGCTGTGCCCGTGG + Exonic
1136717068 16:32289485-32289507 TGCCTAGAGCTCTGTGCCCGGGG - Intergenic
1136835442 16:33495739-33495761 TGCCTAGAGCTCTGTGCCCGGGG - Intergenic
1138578206 16:57922340-57922362 TGTCCCCAGGGCTGGGCCAGTGG - Intronic
1138926112 16:61593257-61593279 TCCCCACAGGGATGTGACCCTGG + Intergenic
1141097602 16:81174021-81174043 TGCCCACAGGGGTGTGTGTGTGG + Intergenic
1141423125 16:83930155-83930177 TGCCCACAGGCCTGGCCCCGGGG + Intronic
1141741975 16:85899328-85899350 TGGCCACTGAGCTGCGCCCGGGG - Intronic
1142213889 16:88821599-88821621 TTCCCACGGGGCTGAGCCTGCGG - Intronic
1203009361 16_KI270728v1_random:228293-228315 TGCCTAGAGCTCTGTGCCCGGGG + Intergenic
1142596477 17:1032127-1032149 TGCCCACCGGGCTGCTCCAGGGG + Intronic
1144586541 17:16491278-16491300 TGGCCCCAGGGCTGTGCCCCTGG + Intronic
1147189116 17:38728795-38728817 TGAGTGCAGGGCTGTGCCCGGGG + Exonic
1147921598 17:43920634-43920656 TACCCCCAGGCCTGTGCCCACGG + Intergenic
1148541161 17:48481773-48481795 TGACATCAGGGCTGTGCCCAGGG + Intergenic
1149449332 17:56737738-56737760 TGCCCACACAGCTCTGCACGGGG - Intergenic
1151328239 17:73391821-73391843 TGCCCTCAGAGCTGGGCGCGTGG + Intronic
1152366912 17:79861671-79861693 TGCTCACAGGGCCGAGCCCAGGG - Intergenic
1152512321 17:80798680-80798702 TGGCCACAGGGCTGAGCCAAGGG + Intronic
1152565610 17:81099005-81099027 TGCCCACCCGGGTGTCCCCGTGG - Intronic
1152615184 17:81334588-81334610 TCCCCCCAGGGCTGTGGCCTGGG + Intergenic
1152671192 17:81608089-81608111 TGCCCACCTGGCTGAGCCTGTGG + Intronic
1154197224 18:12275564-12275586 TGCCCACAGGGACGTGCAGGGGG - Intronic
1157358739 18:46959317-46959339 TGCCCACAGGGCTGTAGCAGTGG - Intronic
1157569623 18:48703870-48703892 TGCCAAAAGGGCTGTGGCCAGGG + Intronic
1157776656 18:50401657-50401679 TGCCCGCCTGGCTGTTCCCGAGG - Intergenic
1158661964 18:59396396-59396418 TGCCCAGGGGACTGTCCCCGGGG - Intergenic
1159342642 18:67155889-67155911 TGCCCCCAGCCCTGGGCCCGGGG - Intergenic
1159605798 18:70473543-70473565 TGCCCACCTGGCCTTGCCCGTGG + Intergenic
1160424244 18:78769422-78769444 TGCCCGCAGGGCAGGGCCCCAGG + Intergenic
1160594340 18:79963893-79963915 TGGTCACTGGGCTGTGCCCTAGG + Intergenic
1160827239 19:1086285-1086307 TGCCCACAGGGCTGTGTGGATGG + Exonic
1161061499 19:2217405-2217427 TGCACACAGGCCAGTGCCCCCGG - Intronic
1161082620 19:2319032-2319054 TCCCCACATGACTGTGGCCGAGG + Intronic
1161326500 19:3666905-3666927 TGCCCAGAGGGCGATGCCCGAGG - Intronic
1162141872 19:8589978-8590000 TGCCCCCAGGACTGTCCCCCTGG - Exonic
1164143070 19:22491867-22491889 TGCCCACAGGCCTGTGCCCACGG + Intronic
1164582214 19:29441720-29441742 TGCCCACTGGGCTGGGGCTGTGG + Intergenic
1164593955 19:29521468-29521490 TGCCCAGTTGGCTGTGCCCGGGG - Intergenic
1165826656 19:38709541-38709563 TGCCCACAGCCCCTTGCCCGAGG - Intronic
1166268221 19:41697705-41697727 GGGCCTCAGGGCTGTGCCCGGGG + Intronic
1166783075 19:45352339-45352361 TGCCCACAGCGGTTTGCCCGTGG - Exonic
1167730510 19:51250859-51250881 TGCCCACAGGCGTGTGCCCCTGG - Intronic
1167752305 19:51388406-51388428 TGGACACAGGGCTGTGGCTGAGG + Exonic
1167776569 19:51561956-51561978 TGGCCACATGGCTTTTCCCGTGG - Intergenic
1168161874 19:54515867-54515889 AACCCACAGGTCTGTGCCCTTGG + Intergenic
1168403687 19:56100026-56100048 AGGCCACAGGGCTGGGGCCGTGG + Intronic
925159105 2:1670798-1670820 TCCCCACAGTGCTGTGCCCTCGG + Intronic
925310847 2:2880560-2880582 TGGGCACAGGGTTCTGCCCGTGG - Intergenic
927826277 2:26312113-26312135 CGCCCACAGGACTGAGCCGGGGG + Intronic
927870352 2:26619233-26619255 TCCCCACAGGGCCCTCCCCGGGG + Intronic
929666694 2:43839029-43839051 GGCCCACAGGTCTGTGACCCTGG - Exonic
929964564 2:46524628-46524650 TGCCCACAGGGCTGCTACCTCGG - Intronic
932887824 2:75562792-75562814 TTCGTACAGGGCTGTGCCCTTGG - Intronic
934900750 2:98158054-98158076 TGAGCACATGGCTATGCCCGAGG - Intronic
935115320 2:100130523-100130545 TGGGCACACGGCTGAGCCCGTGG - Intronic
937318340 2:120946235-120946257 TCCCAACAGGGCTGTGCCTAGGG - Intronic
938140080 2:128787859-128787881 TCCCCACTGGGCTGAGCCAGTGG + Intergenic
938496642 2:131801467-131801489 TGCCGCCAGGTCTGTGCGCGGGG + Exonic
947536720 2:230944266-230944288 TGCCCACATGACTGTCCCGGGGG + Intronic
948906497 2:240982117-240982139 TGCCCCCAGGACACTGCCCGGGG - Intronic
1168975930 20:1965918-1965940 TGCCCAGAGGGCGGGGCCGGGGG + Intergenic
1173019382 20:39254292-39254314 TGGCCACAGCTCTGTGCCCCTGG - Intergenic
1173221688 20:41137245-41137267 TGGCCGCCGGGCTGTGTCCGGGG + Intronic
1173475020 20:43352930-43352952 TCACCACAGGGCTTTGCCCTTGG + Intergenic
1173903295 20:46606815-46606837 TCCCCACAGGGCTGTGGTGGAGG + Intronic
1174194743 20:48764965-48764987 TGCCAGCAGGGCTGTGCTCCTGG - Intronic
1175144449 20:56885115-56885137 TGCCCACAGGCCTGGGCCCGGGG - Intergenic
1175516666 20:59574608-59574630 TACCCACAGGGCTGGCCCTGAGG + Intergenic
1175547288 20:59786477-59786499 TGCCCCCAGGGCTGCTCCCTGGG - Intronic
1175575119 20:60055287-60055309 TGCCCACAGCGCTGGGCACAAGG + Intergenic
1175756796 20:61535345-61535367 TGCCCACGAGGCTGAGCCTGAGG - Intronic
1176229037 20:64021762-64021784 CACACACAGGGCTGTGGCCGAGG - Intronic
1176229042 20:64021815-64021837 CACACACAGGGCTGTGGCCGAGG - Intronic
1176229056 20:64021974-64021996 CACACACAGGGCTGTGGCCGAGG - Intronic
1178358699 21:31930633-31930655 TGCCCACTGGGCTGAGCACTGGG - Intronic
1179885918 21:44314263-44314285 TGACCACGGGGCTGAGCCTGGGG - Intronic
1180189025 21:46153948-46153970 TGCCTGCAGGGCTGTGCTCTGGG - Intronic
1181179039 22:21054525-21054547 TGCCCACAGGGAGCTGCCCCTGG - Intronic
1181473895 22:23157008-23157030 TGCCCCCAGGGGTGTGACCAGGG - Intronic
1181743260 22:24938189-24938211 CCCCCAAAGGGCTGTGCCCAAGG - Exonic
1182362280 22:29753800-29753822 TCCCCACAGGCATGTGCCTGAGG + Intronic
1183640179 22:39088057-39088079 TGGACACAGGGCTGCTCCCGAGG - Intergenic
1184683676 22:46086293-46086315 AACCCACTGGGCTCTGCCCGAGG + Intronic
1184858307 22:47158541-47158563 TGCCCACGGGGCTGTGCAGAGGG - Intronic
1185036852 22:48483871-48483893 TGCCCTGACGGCTGTGCCCACGG - Intergenic
1185208382 22:49553196-49553218 TGCCCACAGGGCTGTGCCCGAGG - Intronic
950530210 3:13548860-13548882 TGCCCACAGGGCAGGGCCAGGGG - Intergenic
951139847 3:19147441-19147463 TCCCCACAGGGCTGTGCCGCAGG + Intergenic
952256614 3:31701270-31701292 TGCCCTTAGGGCTGTTCCCCAGG + Intronic
953920003 3:46945103-46945125 TGGCCACAGGCCTGTGCCCTGGG - Intronic
954397147 3:50298883-50298905 CGCCCCTAGGGCTGAGCCCGGGG + Intronic
954877074 3:53809183-53809205 TACCCACAGGGCCCTGCCCATGG - Intronic
955487198 3:59447311-59447333 TGCCCAGGAGGCTGAGCCCGAGG + Intergenic
960053544 3:113260128-113260150 TGTCCACAGTGCTGTCCACGGGG + Intronic
961347556 3:126274041-126274063 TGCCCACAGGGCTGGGTGTGGGG - Intergenic
961684212 3:128618158-128618180 TGTTCACAGTGGTGTGCCCGTGG - Intergenic
961827838 3:129607844-129607866 TCCTCACAGGGCTGTGACCTTGG - Intergenic
962362152 3:134751651-134751673 TGCCCACATGGATGTGGCTGGGG + Intronic
962806561 3:138931604-138931626 TGCCCACAGGCCTGTGCTTCAGG - Intergenic
963894018 3:150666187-150666209 TGTACTCAGGGCTGTGCCCTGGG + Intronic
967925192 3:194640289-194640311 TTTCCACAGGGCTCTGCACGTGG + Intergenic
967945716 3:194802242-194802264 TGAAGACAGGGCTGTGCTCGTGG - Intergenic
967962204 3:194934819-194934841 TGCACACAGGGCTGCGCTTGGGG - Intergenic
968971408 4:3797657-3797679 ATCCCACAGGGCAGAGCCCGGGG - Intergenic
969322044 4:6418241-6418263 TACCCACAGGGCTGTTGCCCAGG + Intronic
969571029 4:8008469-8008491 GGCCCACAGGGCTCTGCACGGGG + Intronic
971136305 4:23872216-23872238 TGACCAGAGTGCTGTGCCCTTGG - Intronic
975252708 4:72198201-72198223 TGCACACAGGGGTGTGACAGTGG - Intergenic
979859459 4:125676128-125676150 CACCCTCAGGCCTGTGCCCGTGG + Intergenic
983238772 4:165207969-165207991 TGTCCCCAGAGCTGCGCCCGCGG - Intronic
985118929 4:186619979-186620001 GGACCACAGGGCTGTGCACCTGG + Exonic
985546767 5:513877-513899 TGGCGACAGGGCTGCGCCCCAGG + Intronic
986494826 5:8331768-8331790 TGCCCACAGGGCGGTACTCAGGG - Intergenic
989195721 5:38714344-38714366 TGCCCACAGGGTGGTGTCCTGGG - Intergenic
997630816 5:135367744-135367766 TGCCCACAGAGCAGGGCCCTTGG - Intronic
1001847646 5:174936088-174936110 TTCACACAGGGATGTGCCGGTGG - Intergenic
1001931858 5:175678813-175678835 CTCCCACAGGGCTGTGTCTGGGG + Intronic
1002107124 5:176885276-176885298 TGCCCAAAGAGCAGGGCCCGGGG + Intronic
1002194398 5:177494478-177494500 TGCCCACAGGGCTGGCTCCTGGG + Intronic
1002586803 5:180253664-180253686 TACCCACAGGACTGTGCATGCGG - Intronic
1004260576 6:14104066-14104088 TGCGCTCAGGTCTGTGCACGTGG + Intergenic
1007733711 6:43967476-43967498 TTCCCACAGGGTTCTGCCTGTGG - Intergenic
1007742180 6:44019245-44019267 ACCCCAAAGGGCTGTGCCTGAGG - Intergenic
1011441589 6:87392744-87392766 TGCCCACAGGAGTGTGCCTCCGG + Exonic
1012979189 6:105812124-105812146 TGCCCACTGGGCTGGGCACAGGG - Intergenic
1014941596 6:127446803-127446825 TGCCCACATGCCTGTGCCCATGG - Exonic
1016518365 6:144922515-144922537 GGCCCATAGGGCTGTGTCCAGGG - Intergenic
1019054588 6:169213911-169213933 AGCCCACAGGGCTGTGGCCGTGG + Intergenic
1020644097 7:10793018-10793040 AGCCCACAGGGCTCTGCCTCTGG + Intergenic
1022396070 7:29989287-29989309 TGCCCACTGGGATGTGCCTGTGG - Intronic
1022589056 7:31643527-31643549 TGCTCAGAGGGCTGTGGCCTTGG + Exonic
1024440197 7:49408076-49408098 TACCCTCAGGCCTGTGCCCATGG + Intergenic
1028346873 7:89793840-89793862 TACCCTCAGGCCTGTGCCCACGG - Intergenic
1031134771 7:117873159-117873181 TGCCCACACGGCGGAGGCCGCGG - Intronic
1031232255 7:119123348-119123370 TGTCCTCAGGCCTGTGCCCACGG + Intergenic
1038100719 8:24371357-24371379 TGCACACAGCACTGTGTCCGAGG - Intergenic
1040063219 8:43122397-43122419 TGCCCACAGGGCTGTGGTGCAGG - Exonic
1040336967 8:46421002-46421024 AGCCCCCAGGGCTGTCCCCGAGG + Intergenic
1040782097 8:51121651-51121673 CGCCCTCAGGCCTGTGCCCGCGG + Intergenic
1041394119 8:57374260-57374282 AGACCACAGGGCTGGGCCCTTGG + Intergenic
1042943083 8:74127151-74127173 TCCACACAGGGGTGTGCCTGTGG + Intergenic
1043137733 8:76549293-76549315 AGCCCACTTGGCTGTGCCCATGG + Intergenic
1043495135 8:80792028-80792050 TGCCCCCAGGGCTGTGCCTTTGG - Intronic
1044533455 8:93333981-93334003 TGACCACAGAGCTATGCTCGAGG - Intergenic
1047183276 8:122609548-122609570 TGCCCACTAGGCTGTGGGCGTGG - Intergenic
1048983199 8:139714355-139714377 TGAACACAGGGCTCGGCCCGCGG + Intergenic
1049282575 8:141757891-141757913 TGCCCACAGAGCTTTCCCCTCGG - Intergenic
1049465119 8:142747706-142747728 TGGGCACAGGGCTGAGGCCGAGG + Intergenic
1049670894 8:143869420-143869442 TGCCCACAGGCCTGGGCCAGAGG - Exonic
1056502567 9:87224092-87224114 TGACCACAGGTATGTGCCCTTGG - Intergenic
1056581445 9:87890047-87890069 TCCCCAGAGGGCTCTGCCCAGGG + Intergenic
1057064549 9:92036897-92036919 TGTCCACAGAGTTGTGCCTGAGG + Intronic
1057228021 9:93302656-93302678 TGCCCAGGTGGCTGTGCCCAGGG + Intronic
1061402482 9:130376003-130376025 TGCCCACCCGGCTGTGCCCCAGG - Intronic
1062310107 9:135930819-135930841 TGGCCACAGGGCACTGCCCAGGG + Intergenic
1062478893 9:136742522-136742544 GGCCCAGAGAGCTGTGGCCGAGG - Intronic
1062609435 9:137367377-137367399 TCCCCACCTGGCTCTGCCCGAGG + Intronic
1185461386 X:334176-334198 TGCCCAGAGCTCTGTGCCAGGGG - Exonic
1186382599 X:9076799-9076821 TGCTCCCGGGGCTGTGCCCCAGG + Intronic
1192775021 X:74235002-74235024 TGTCCACATGGTTGTGCCCTTGG - Intergenic
1199673214 X:150163729-150163751 TGCCCATAGGGCTGTCTCCAAGG - Intergenic