ID: 1185208391

View in Genome Browser
Species Human (GRCh38)
Location 22:49553210-49553232
Sequence CTGTGGGCAGGGAGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2346
Summary {0: 1, 1: 2, 2: 24, 3: 289, 4: 2030}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185208382_1185208391 -9 Left 1185208382 22:49553196-49553218 CCTCGGGCACAGCCCTGTGGGCA 0: 1
1: 0
2: 4
3: 29
4: 215
Right 1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG 0: 1
1: 2
2: 24
3: 289
4: 2030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185208391 Original CRISPR CTGTGGGCAGGGAGGGGAGG AGG Intronic
Too many off-targets to display for this crispr