ID: 1185208508

View in Genome Browser
Species Human (GRCh38)
Location 22:49553754-49553776
Sequence CCCGGATGCTGCGTGTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185208508_1185208517 11 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208517 22:49553788-49553810 TAAAGATGGAGACATGGGGCGGG 0: 1
1: 0
2: 2
3: 40
4: 485
1185208508_1185208519 26 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208519 22:49553803-49553825 GGGGCGGGAGGAAGCTAAGCAGG 0: 1
1: 0
2: 1
3: 28
4: 330
1185208508_1185208520 27 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208520 22:49553804-49553826 GGGCGGGAGGAAGCTAAGCAGGG 0: 1
1: 0
2: 2
3: 45
4: 569
1185208508_1185208514 6 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208514 22:49553783-49553805 GAAAGTAAAGATGGAGACATGGG 0: 1
1: 0
2: 5
3: 69
4: 676
1185208508_1185208518 14 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208518 22:49553791-49553813 AGATGGAGACATGGGGCGGGAGG 0: 1
1: 0
2: 2
3: 61
4: 452
1185208508_1185208516 10 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208516 22:49553787-49553809 GTAAAGATGGAGACATGGGGCGG 0: 1
1: 0
2: 3
3: 20
4: 419
1185208508_1185208515 7 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208515 22:49553784-49553806 AAAGTAAAGATGGAGACATGGGG 0: 1
1: 0
2: 5
3: 43
4: 612
1185208508_1185208512 -3 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208512 22:49553774-49553796 GGGAACACGGAAAGTAAAGATGG 0: 1
1: 0
2: 0
3: 32
4: 327
1185208508_1185208513 5 Left 1185208508 22:49553754-49553776 CCTAGGAACACGCAGCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1185208513 22:49553782-49553804 GGAAAGTAAAGATGGAGACATGG 0: 1
1: 0
2: 3
3: 74
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185208508 Original CRISPR CCCGGATGCTGCGTGTTCCT AGG (reversed) Intronic