ID: 1185210989

View in Genome Browser
Species Human (GRCh38)
Location 22:49570373-49570395
Sequence CTCTCTCTGCAAGGGTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185210983_1185210989 3 Left 1185210983 22:49570347-49570369 CCAGAGCAGAGGCAGGACAGCCA 0: 1
1: 0
2: 2
3: 36
4: 351
Right 1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
1185210980_1185210989 12 Left 1185210980 22:49570338-49570360 CCATGAGGCCCAGAGCAGAGGCA 0: 2
1: 1
2: 5
3: 50
4: 442
Right 1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
1185210982_1185210989 4 Left 1185210982 22:49570346-49570368 CCCAGAGCAGAGGCAGGACAGCC 0: 1
1: 0
2: 1
3: 34
4: 335
Right 1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185210989 Original CRISPR CTCTCTCTGCAAGGGTACGT GGG Intronic
901435744 1:9246435-9246457 CACTCTCTGCCAGGGTTCCTGGG - Intronic
911564578 1:99448622-99448644 CTCTCTCTGCACAAGTACATAGG - Intergenic
915755982 1:158260299-158260321 CACTCTGAGCAAGGGTAAGTGGG - Intergenic
918093073 1:181314033-181314055 CTCTCTCTGCTATAGTACGGGGG + Intergenic
923013018 1:230104153-230104175 CTGGCTCTGCAAGGGTCAGTAGG + Intronic
923147211 1:231206643-231206665 CTCTTTCAGGAAGTGTACGTCGG + Exonic
1070844181 10:79508283-79508305 CTCTGTCTGCAAATGTACGCAGG + Intergenic
1070929616 10:80252028-80252050 CTCTGTCTGCAAATGTACGCAGG - Intergenic
1072550030 10:96470173-96470195 CACTCTCTGCAAGGTGATGTGGG + Intronic
1074229836 10:111522935-111522957 CTCTCTCTGCAAGGGCAATGGGG - Intergenic
1077077415 11:707812-707834 CTGAGTCTGCAAGGGTGCGTTGG + Intronic
1078179744 11:9001590-9001612 CTCTCACTGCAAGGGAAATTTGG - Intronic
1078540015 11:12205864-12205886 CTTTCTCTGTAGGGGTAGGTGGG + Intronic
1083875710 11:65523553-65523575 CTATCTCTGCAAGGGGACTGCGG - Intergenic
1084623600 11:70291289-70291311 ATCTCTCTTTAAGGGTATGTAGG - Intronic
1084919875 11:72460327-72460349 CTCTCTCAGCAAGGCTGAGTGGG - Intergenic
1086896348 11:92317426-92317448 CTCCTTCTGCAAGGCTACCTTGG - Intergenic
1087076074 11:94128488-94128510 CTCCCTCTGCAAGGCACCGTCGG + Intergenic
1087667440 11:101067048-101067070 CCATCTATGCAAGGGTAAGTTGG - Intronic
1090192929 11:124788190-124788212 CTCACTCTGCATGGGTAGTTAGG - Intronic
1090957369 11:131525247-131525269 CTCTCTCTGAAGTGGGACGTGGG + Intronic
1103904421 12:124320196-124320218 CTCTTTCTTTAAGGGTAGGTGGG + Intergenic
1104503692 12:129310454-129310476 CTCTCTCTGCAAGGTCCCCTTGG - Intronic
1112069891 13:95837841-95837863 CTCTCTCTCCAAGAGTATGAAGG + Intronic
1113218194 13:108068254-108068276 GTCTCTCTGCCAGGGTTGGTGGG - Intergenic
1113916092 13:113874962-113874984 CTCTCTCTGCTAGGCTTCCTGGG - Intergenic
1125522423 15:40355729-40355751 ATCACTCTGCAAGGGTTCCTGGG + Intronic
1128063585 15:64750371-64750393 CTCTCTCCGCAGGGGTATGAAGG - Exonic
1133498961 16:6347110-6347132 CTTTCTCTTCAAGAGTAAGTGGG + Intronic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1144383453 17:14726367-14726389 CTCCCTCTGCAAGAGAACCTCGG - Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151306884 17:73268276-73268298 CTCTCTTTGCAAGGTTTTGTGGG - Intergenic
1154044657 18:10893516-10893538 GTCTCTCTGCATGGGTTCCTTGG + Intronic
1155658587 18:28220915-28220937 GTCTCTCTGCAAGGGTTCAAGGG - Intergenic
1158754609 18:60306809-60306831 CTCTCACTGAAAGGGTATCTAGG + Intergenic
1159682383 18:71370840-71370862 GTCTCTCTGCAAGGGTCAGCTGG + Intergenic
1160202721 18:76808779-76808801 CTCTCTCTGCAGGGGTGCGTTGG - Intronic
1161772626 19:6239351-6239373 CTCCCTCTGCAGGGGTGCCTCGG - Intronic
1167765662 19:51480536-51480558 CTCTCCCTGCCAGTGTACATGGG - Exonic
1168660039 19:58158344-58158366 CACTCACTGCAAGGGTCTGTGGG + Intergenic
925497159 2:4464823-4464845 CTCCCTCTGCAAGGCGTCGTGGG - Intergenic
927095149 2:19742645-19742667 CTCTCCCTGGAGGGGTAGGTGGG - Intergenic
935737987 2:106121536-106121558 CTCTGTGTGCATGGGTACTTAGG - Intronic
938626712 2:133117841-133117863 CTCACACTGCAAAGGTAGGTTGG + Intronic
946548724 2:220776678-220776700 CTCTCTCTTCAATGGTCCCTTGG + Intergenic
947612442 2:231532378-231532400 CTGCCTCTGCAAGGCTAGGTGGG - Intergenic
947715052 2:232335148-232335170 TTCTCTCTCCAAGGGGACATGGG + Intronic
947720600 2:232367387-232367409 TTCTCTCTCCAAGGGGACATGGG + Intergenic
947734127 2:232446099-232446121 TTCTCTCTCCAAGGGGACATGGG + Intergenic
948762720 2:240202765-240202787 CTCCCTCTGCAAGGGTGAGGTGG - Intergenic
1169486206 20:6035513-6035535 CTCTCTCTTCATGGGTTCCTAGG - Intronic
1171150928 20:22825973-22825995 CTCTCATTGAAAGGGTATGTTGG + Intergenic
1172864908 20:38088532-38088554 GTGTCTCTGCAAGGGTAAGTAGG - Intronic
1175682331 20:60998680-60998702 CTCTCTCTGCAAAGCAACCTTGG - Intergenic
1178838020 21:36114677-36114699 CTGTCTCTGGAAGGGGACATGGG - Intergenic
1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG + Intronic
950523913 3:13512599-13512621 CTGTCTGTGCAAGGAGACGTTGG - Intergenic
951288373 3:20844215-20844237 CTCACTCTGCAAAGTTAAGTAGG + Intergenic
953404324 3:42653140-42653162 CACTCTCTGCCAGAATACGTAGG - Intergenic
954962864 3:54581320-54581342 GTCACTCTGCAAGGGTATGTGGG - Intronic
963006045 3:140727124-140727146 CTCTCTCTGCAAGTTCACCTGGG - Intergenic
969169083 4:5344914-5344936 CCATCTCTACAAGGCTACGTGGG + Intronic
970428005 4:15963224-15963246 CTTTCTCTGCAAGGGTGGGGAGG + Exonic
972138158 4:35919097-35919119 CTCTCTTGGAAAGAGTACGTAGG + Intergenic
972819833 4:42687949-42687971 TTCTCTCTGCAAAAGTACCTTGG - Intergenic
973572011 4:52250336-52250358 CTCACTCTGAAAGGGAACGAGGG - Intergenic
975682105 4:76887064-76887086 CTCTATCTCCAAGGGAACTTGGG + Intergenic
975834027 4:78401912-78401934 TACTCTCTGCTAGGCTACGTGGG + Intronic
979671745 4:123366955-123366977 CTCTCTCTGTGTGTGTACGTGGG - Intergenic
980174157 4:129324740-129324762 CCCTCCCTGCAAGGTTACCTTGG - Intergenic
981996051 4:150976891-150976913 CTCTCTCTGTAGGTGGACGTTGG - Intronic
998600168 5:143577182-143577204 GTCTCTCTGCAAGGGCCCCTTGG - Intergenic
999206177 5:149849778-149849800 CACCCTCTGCAAGGGGACGTGGG - Exonic
999701582 5:154233453-154233475 CTGTCTCTGCAAGGAAAAGTGGG + Intronic
1009860050 6:69317180-69317202 CTCTCTCTGCATGGGTGAGTGGG + Intronic
1021006033 7:15396227-15396249 CACTCACTGCGAGGGTCCGTGGG - Intronic
1021253127 7:18356583-18356605 CTCTCTCTACAGGGGAACATAGG + Intronic
1028962663 7:96766907-96766929 CTCTCTCTGTATGTGTATGTTGG - Intergenic
1032561830 7:132900437-132900459 CTCACTCTGTGAGGGTATGTGGG - Intronic
1032995513 7:137441586-137441608 CTCTCTATGCAAGAGTACCATGG + Intronic
1033043232 7:137937404-137937426 CTCTCCCTGCAAGGGGAGGAGGG - Intronic
1033608342 7:142943457-142943479 GTCACTCTGTAAGGGTAGGTAGG - Intronic
1033911756 7:146272333-146272355 CTGTCTCTCCAATGGCACGTGGG + Intronic
1033980697 7:147161624-147161646 CTCTCTCTCATAGGGTACGCTGG + Intronic
1034261120 7:149756260-149756282 CCCTCTCTGCAAGGGGACAGTGG + Intergenic
1035337219 7:158137680-158137702 CTCTCTCTGCACGGGTGCAGAGG - Intronic
1038916601 8:32031270-32031292 CTCTCTTTCCAAAGGTAGGTAGG + Intronic
1040080649 8:43281225-43281247 CTCTCCCTGCCTGGGTACCTTGG + Intergenic
1041399164 8:57423128-57423150 CTCTGTCCATAAGGGTACGTGGG - Intergenic
1048538234 8:135317663-135317685 CTTTCTCTGAAAGGGTATGCTGG - Intergenic
1051081474 9:13299416-13299438 CTCTCTCTGCAAGGTTCCACAGG - Intergenic
1051140321 9:13971729-13971751 CCCTCTCTTCATGGGTACGTGGG - Intergenic
1059434921 9:114270458-114270480 CTCCCTCTGCAGGGTGACGTGGG - Intronic
1062071508 9:134557608-134557630 CTAGCTCTGCATGGATACGTGGG + Intergenic
1197648375 X:129040969-129040991 CTCCCTCTGGAAGGGAAGGTGGG - Intergenic