ID: 1185211579

View in Genome Browser
Species Human (GRCh38)
Location 22:49573541-49573563
Sequence AGCAAGGCCCAGAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 1, 2: 11, 3: 68, 4: 603}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185211568_1185211579 16 Left 1185211568 22:49573502-49573524 CCAGGCTCACCTGGGACATGGAG 0: 1
1: 0
2: 1
3: 25
4: 272
Right 1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 11
3: 68
4: 603
1185211571_1185211579 7 Left 1185211571 22:49573511-49573533 CCTGGGACATGGAGGCAAGGCCC 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 11
3: 68
4: 603
1185211564_1185211579 29 Left 1185211564 22:49573489-49573511 CCGGAGAGAGAGGCCAGGCTCAC 0: 1
1: 0
2: 2
3: 34
4: 340
Right 1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG 0: 1
1: 1
2: 11
3: 68
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185211579 Original CRISPR AGCAAGGCCCAGAGTGGGCA GGG Intronic
900406062 1:2493555-2493577 CCCACGGCCCAGAGTGGCCAAGG - Intronic
900659715 1:3776420-3776442 AGAAAGGCCCAGAGAGGACAGGG - Intergenic
901056125 1:6449313-6449335 AGGCAGGCCCAGATTGGGGAAGG - Intronic
901913418 1:12479132-12479154 AGCAAGGCCTGGAGTGGCCTGGG + Intronic
902069496 1:13722364-13722386 AGAAAGGCCCAGAGTAGCAAGGG + Intronic
902388267 1:16088407-16088429 ACCAAGGCTCAGAGAGGGCGTGG + Intergenic
902478215 1:16699127-16699149 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
902478231 1:16699182-16699204 AGGCAGGCCCAGACTGGGGAAGG + Intergenic
902536462 1:17121684-17121706 GGCAAGGCCGAGTGAGGGCAGGG + Intergenic
902688720 1:18096303-18096325 ACGAAGGCCCAGCGAGGGCAAGG + Intergenic
902799661 1:18821368-18821390 GGCAAGGCCTGGTGTGGGCAGGG - Intergenic
902822357 1:18951059-18951081 ACCAAGGCCCAGAGGGGGGCTGG - Intronic
902919722 1:19658510-19658532 AGCGAGGCCCAGAGGCAGCAGGG + Intergenic
903011527 1:20334289-20334311 AGGAAGGCCCGGACTGTGCAAGG - Intronic
903133170 1:21292261-21292283 ATGAGGGCCCAGAGTGGGCAGGG - Intronic
903214870 1:21838443-21838465 AACAAGGCCCAGGATGGGCTGGG - Intronic
903287363 1:22285527-22285549 ACCAAGGCCCGGAGAGGGCGGGG - Intergenic
903389557 1:22954208-22954230 ACCAAGGCCCAGAGAGGGGCGGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
903772418 1:25772285-25772307 ACCAAGGCCTAGAGAGGGGAAGG + Intronic
903885331 1:26537604-26537626 GCCAAGGCCCAGAGTGTACAAGG - Intronic
904053538 1:27655662-27655684 TGCCAGGCCCAGAGTAGGCGCGG + Intergenic
904431939 1:30470000-30470022 ACGGAGGCCCAGAGAGGGCAAGG - Intergenic
904500359 1:30909287-30909309 ACCGAGGCCCAGAGAGGGCCGGG - Intergenic
904532918 1:31181185-31181207 ACCGAGGCTCAGAGAGGGCAAGG + Exonic
905029978 1:34875697-34875719 ATCATGGCCCAGAGTGTGCTGGG + Intronic
905166946 1:36088518-36088540 AGGGAGGCCCACAGGGGGCAAGG + Intergenic
905380268 1:37556941-37556963 AACAAGGCCCACACTGGACAGGG + Exonic
905407065 1:37740996-37741018 AGGAAGACCAAGGGTGGGCAAGG + Intronic
905620782 1:39444739-39444761 AGCCAGACCCAGAGTCGTCACGG - Exonic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
906638547 1:47427011-47427033 AGCACACCCCAGGGTGGGCATGG - Intergenic
906689253 1:47781823-47781845 AACCAAGCCCAGAGAGGGCAGGG - Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
908483318 1:64565415-64565437 AGCAAGGACCAGAGTAAACAGGG + Intronic
909541140 1:76792786-76792808 AGCAAGGGGCAGTGTGGGAAAGG - Intergenic
909657158 1:78045003-78045025 AGCAAGGAGCAGGGTGGGGACGG + Intronic
910873049 1:91852552-91852574 AGAAAGACCCAGAGTGGATAGGG - Intronic
912491922 1:110067145-110067167 AGCAAGGCCCAGAAGAGGAAAGG + Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
913389001 1:118289900-118289922 ACCAGGGCCAAGAATGGGCATGG + Intergenic
915271459 1:154756534-154756556 ACCAAGGCCCTGAGCTGGCAAGG - Intronic
915287428 1:154861867-154861889 AACGAGGCCCAGAGAGGGGAAGG + Intronic
915471821 1:156130249-156130271 AGTAAGGCCCTGTGTGGGAAGGG + Intronic
915979066 1:160408876-160408898 ACTAAGGTACAGAGTGGGCAAGG - Intronic
916199561 1:162257356-162257378 AGCCAGGCCCAGACCAGGCACGG + Intronic
916502542 1:165399265-165399287 AGCAAAACACAGAGTGGTCAGGG - Intergenic
916538238 1:165725362-165725384 AGAAAGGCCCAGTCTGGTCAAGG + Exonic
916549626 1:165837615-165837637 AGCAAGGACCACACAGGGCAAGG - Intronic
918531879 1:185531870-185531892 AGCAAGGCCAAGCTTCGGCAAGG + Intergenic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
918820740 1:189250778-189250800 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
919057919 1:192593682-192593704 AGAAAGGCCAAGAGAGGGCAAGG + Intergenic
919896852 1:202014314-202014336 AGCCAGGCCCTGGGTGGGCACGG - Intronic
920309786 1:205042266-205042288 AGCGAGGCTCAGAGAGGGCAGGG + Intergenic
920840601 1:209550675-209550697 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
921165158 1:212501893-212501915 ACCAAGGCCCAGAGAGGAGAAGG + Intergenic
924585236 1:245355925-245355947 AGGAAGGCCAAGAGGAGGCAGGG - Intronic
1065913007 10:30326521-30326543 AGCCAGGGCCAAAGTGGTCAAGG + Exonic
1065976661 10:30847859-30847881 AGCCAGGCACAGAGTGGTGAGGG - Intronic
1066072794 10:31837608-31837630 AGCAAGGCCCACTCTAGGCAGGG + Intronic
1067058824 10:43067464-43067486 AGAAAGGCCCACACTGGGAAGGG - Intergenic
1067662816 10:48249290-48249312 AGCAAGACCCAGAGGAGACATGG + Intronic
1068130628 10:52890507-52890529 AGCCAGGCGCAGAGTGGTGAGGG - Intergenic
1068283539 10:54908199-54908221 AGCCTGGCCCAGAGTGGCAAGGG + Intronic
1069633556 10:69912139-69912161 AACAAAGCCCAGAGTGCTCAGGG - Intronic
1069721668 10:70553781-70553803 AGCAGGGCTCAAGGTGGGCAGGG - Intronic
1069761002 10:70811418-70811440 AGCATGCCCTAGAGAGGGCAAGG + Intergenic
1069826609 10:71258616-71258638 AGGAAGGTCCAGAGAGGGGAAGG + Intronic
1069840797 10:71338118-71338140 AGACTGGCCCAGGGTGGGCATGG - Intronic
1069840812 10:71338152-71338174 AAAGAGCCCCAGAGTGGGCATGG - Intronic
1070755386 10:78988848-78988870 AGCAAAGCCCTAAGTGAGCAAGG - Intergenic
1070794109 10:79207115-79207137 CGCAGGGCCCAGAATTGGCAGGG - Intronic
1072163524 10:92789773-92789795 AGCAGGGGCCAGGCTGGGCATGG - Intergenic
1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG + Intronic
1072660494 10:97360762-97360784 ACTAAGGCCCAGAGAGGGCAAGG + Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1074409452 10:113212976-113212998 AGCAAGGCACAGGATGGGGATGG + Intergenic
1075250561 10:120867478-120867500 AGCAAGGCCCTGAGTTGGCATGG - Intronic
1075481169 10:122783089-122783111 AGCCTGGCACAGTGTGGGCAAGG + Intergenic
1075592534 10:123703119-123703141 ACCGAGGCCCAGAGAGGGGAAGG + Intergenic
1075697371 10:124447203-124447225 AGCAAGGTCCAGAAACGGCAAGG + Exonic
1076172698 10:128335676-128335698 GGCAATGCCCAGTGTTGGCAAGG + Intergenic
1076883250 10:133249632-133249654 AACGAGGCCCAGAGTGGGCACGG + Intergenic
1076978771 11:194325-194347 AGCAAGGCCCTCAGTGGGGGGGG - Intronic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077138687 11:1014023-1014045 AGCAGCGCCCAGGGTGGGCATGG + Intronic
1077285922 11:1765931-1765953 AGGAGGGCCCAGGGTGGCCAGGG - Intergenic
1077323278 11:1952007-1952029 ACCAAGACCCACAGGGGGCAGGG - Intronic
1077352120 11:2097844-2097866 AGCACGGGCCAGAGTGGGGAGGG - Intergenic
1077415161 11:2421347-2421369 GCCGAGGCCCAGAGAGGGCAAGG + Intronic
1077455099 11:2673718-2673740 TGGAAGGCCCAGACTGGACAGGG + Intronic
1077601791 11:3579862-3579884 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1077907345 11:6544718-6544740 AGCAGGGCTCAGCGTGGGAAAGG + Intronic
1078235917 11:9484503-9484525 AGCAAGGTTCAGGCTGGGCACGG - Intronic
1078338238 11:10480820-10480842 GGCATAGCCCAGAGTGGGGAGGG - Intronic
1079615681 11:22489880-22489902 AGCCTGGCCCAGTGGGGGCAGGG + Intergenic
1080441204 11:32296253-32296275 AGCCAGGCGCAGACTGGGCTGGG + Intergenic
1080763769 11:35277235-35277257 AGAGAGGCCCAGAGTTGGAACGG - Intronic
1081021787 11:37957193-37957215 AGCAAGGCCTGGAGTGGGAAGGG - Intergenic
1081607770 11:44537901-44537923 AGAAAGGCCCAGAGAGGGGAAGG + Intergenic
1081669059 11:44933278-44933300 AGCCAGGCACAGGGTGGACAGGG + Exonic
1081702996 11:45163675-45163697 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1081783939 11:45733184-45733206 AGCAAGGGCAGCAGTGGGCAGGG + Intergenic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1083490595 11:63012516-63012538 AGTAATGCCCACACTGGGCATGG - Intronic
1083678253 11:64339977-64339999 AACAAGGCCCAGAGAGGTGAAGG + Intergenic
1083807734 11:65084825-65084847 AGCAGGGCACTGGGTGGGCAAGG + Intronic
1083811589 11:65109611-65109633 AGCTGGGCACAGATTGGGCAAGG - Intronic
1083897729 11:65628586-65628608 AGCAAGTCCCACAGCTGGCAGGG - Exonic
1083946283 11:65924856-65924878 GGCAAAGCCCAGAGAGGGAAAGG - Intergenic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084257700 11:67954409-67954431 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084400936 11:68942496-68942518 AGCAAAGCCCAGAGCTGGCAGGG - Intergenic
1084488410 11:69464312-69464334 AGGAAGGCACGGAGAGGGCAAGG + Intergenic
1084536979 11:69763011-69763033 CGCATGGCCCAGTGTGGGCTGGG + Intergenic
1085023858 11:73225298-73225320 AGAAAGGCCCAGACTGGGGTAGG + Intronic
1085039257 11:73317381-73317403 AAGCAGGCTCAGAGTGGGCAGGG + Intronic
1085041693 11:73330698-73330720 ATCTAGGCCCAGAGAGGGGATGG - Intronic
1085047994 11:73364326-73364348 ACCAAGGCCCACAGAGGGCCTGG - Intronic
1085154981 11:74285275-74285297 ACCGAGGCCCAGAGAGGGGAAGG - Intronic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085471600 11:76761865-76761887 AGCGAGGCCCAGGGTGGGCAGGG + Intergenic
1085512432 11:77095206-77095228 CTCAAGGCCCAGAGAGGGCTGGG + Intronic
1086850356 11:91800385-91800407 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
1089500547 11:118929215-118929237 AGCAGGGGCCAGGGTGGGAACGG + Intronic
1089698370 11:120229339-120229361 AGGAAGGCACAGGGTGGGAATGG - Exonic
1089710508 11:120311164-120311186 AGCAGGGGCCAGACTGTGCAGGG + Intronic
1090794591 11:130123872-130123894 AGCAAACACCCGAGTGGGCAGGG - Intronic
1202806266 11_KI270721v1_random:7202-7224 ACCAAGACCCACAGGGGGCAGGG - Intergenic
1091787784 12:3253406-3253428 AACGAGGCCCAGAGAGGTCAAGG - Intronic
1092154688 12:6274536-6274558 AGCAAGGCCCAGGATGGGAGGGG + Intergenic
1092427932 12:8389205-8389227 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1092429207 12:8396218-8396240 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1096624808 12:52888075-52888097 ACCAAGGCCCAGAGAAGGCAGGG + Intergenic
1096627648 12:52905138-52905160 GGCTAGGCCCAGAGGGGGCTGGG + Intronic
1096745222 12:53722401-53722423 GGCCAGGCCTAGAGTGGGGAGGG - Intronic
1096797341 12:54086111-54086133 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1097177013 12:57149194-57149216 AGAAAGGCCAAGGATGGGCATGG - Intronic
1097191068 12:57219909-57219931 AGCAAGGCAAAGAGGGGTCAGGG + Intronic
1097210729 12:57366975-57366997 AACAAAGCCCAGACTGGGCGTGG - Intronic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1100410339 12:94311206-94311228 AGGCATGCCCAGAGAGGGCATGG + Intronic
1101606679 12:106252133-106252155 GGCAAGGCCCCCAGTGGCCAAGG + Intronic
1101875846 12:108596653-108596675 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1101943605 12:109119245-109119267 AGCAAGGGTCAGAGTGGCTAAGG - Intronic
1102019744 12:109673997-109674019 AGCAGGGCCCAGCCTGGCCAGGG - Intergenic
1102023938 12:109702601-109702623 AGCAATGCCTGCAGTGGGCAAGG - Intergenic
1102502242 12:113360394-113360416 AGCGAGGCCCAGCATGGGGAGGG + Intronic
1102514905 12:113439887-113439909 AGCAAAGCTCAGAGAGTGCAGGG + Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1103042512 12:117707531-117707553 ACCAAGGCTCAGAGAGGCCAAGG - Intronic
1103612605 12:122133370-122133392 AGGAAGGCTCACAGTGGGGAGGG - Exonic
1103951941 12:124556088-124556110 AGAGAGGCCCAGAGTGGCCAGGG - Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104513269 12:129401060-129401082 GGCCAGGCCCAGTGTGGGAAAGG - Intronic
1104646583 12:130501955-130501977 AGCAAGGCTCAGAGTCTGCCTGG - Intronic
1104736080 12:131136695-131136717 AGGCAGGCTCAGCGTGGGCAAGG - Intronic
1105306337 13:19171704-19171726 ACCAAGTCACAGAGTGGTCAAGG + Intergenic
1106207738 13:27615358-27615380 AACACGCCCCAGAGAGGGCATGG - Intronic
1106315678 13:28591203-28591225 TGCAAAGCCCAGACTGGGAAAGG - Intergenic
1106382817 13:29256459-29256481 GGCTGAGCCCAGAGTGGGCAAGG + Intronic
1106489973 13:30212430-30212452 AGCCAGGCACAGAGTGGTGAGGG - Intronic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1110047109 13:70844549-70844571 AGCCAGGCACAGAGTGGCAAAGG + Intergenic
1111485820 13:88896698-88896720 AGCCAGGCACAGAGTGGAGAGGG - Intergenic
1111804387 13:93021214-93021236 AGCAAGGGCAAGAGAGAGCATGG + Intergenic
1114446866 14:22795357-22795379 AGCAATACTCAGATTGGGCACGG - Intronic
1114648704 14:24269867-24269889 AGTAAGGCCCAGAATGGGGAGGG - Intronic
1115056107 14:29129162-29129184 AGCTAGGCCAAAAGAGGGCAGGG - Intergenic
1117406899 14:55412481-55412503 AGCATGGCCCAGGGTAGGGAAGG - Intergenic
1118211226 14:63767560-63767582 ATCAGGGCCCAGTGTGGCCACGG - Intergenic
1118259588 14:64234794-64234816 AGATGGGCACAGAGTGGGCATGG - Intronic
1119286266 14:73457938-73457960 AGGAAGGCCGAGGGTGGCCAGGG - Intronic
1119473283 14:74912301-74912323 GGCCTGGCCCAGCGTGGGCAGGG - Intronic
1119945130 14:78685402-78685424 AGCAAGGGCCAGATTGTACAAGG - Intronic
1120422737 14:84308776-84308798 AGCAACGACTAGAGAGGGCAGGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121572092 14:94954084-94954106 AGCAAGTCCCAGTGTGAGCACGG + Intergenic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1121888962 14:97571632-97571654 AGCAAGGACTAGAGAGGGCAAGG + Intergenic
1122059769 14:99129274-99129296 AGCAAGGCCCAGAGATGGGAGGG - Intergenic
1122060293 14:99132613-99132635 AACAAGGTCCAGAGAGGGAATGG - Intergenic
1122136755 14:99637849-99637871 ACCAATGCCCAGAGAGGTCAAGG + Intergenic
1122362217 14:101174247-101174269 GACGAGGCCCAGAGAGGGCAAGG + Intergenic
1122398278 14:101450720-101450742 GGCCAGGCCCAGAGGGGTCAGGG - Intergenic
1122451957 14:101816219-101816241 AGCAAGGCCTAGAGTGGAGTGGG - Intronic
1122856406 14:104562316-104562338 ATCAAGGCCCAGGGTGGGCCAGG + Intronic
1122886298 14:104711903-104711925 AAACAGGCCTAGAGTGGGCAAGG + Intronic
1123071056 14:105642741-105642763 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1123076016 14:105667782-105667804 GGCATGCCCCCGAGTGGGCATGG + Intergenic
1124054072 15:26225486-26225508 AGCAGAGCGCAGAGTGAGCAGGG + Intergenic
1124513583 15:30347981-30348003 AGAGAGGGCCAGGGTGGGCAGGG - Intergenic
1124729338 15:32182784-32182806 AGAGAGGGCCAGGGTGGGCAGGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125747695 15:42008339-42008361 AGGAAGGGCCCCAGTGGGCAAGG + Intronic
1126811194 15:52406520-52406542 AGCAAGGCCCACAATGGTCCTGG + Intronic
1126868493 15:52962229-52962251 AGCAAGACCGAGAATGGGGAGGG - Intergenic
1127283808 15:57515484-57515506 AGAAAGGCCCAGGGAGGACAAGG - Intronic
1127568763 15:60219953-60219975 AAGAGGGCCCAGATTGGGCAAGG - Intergenic
1127668144 15:61169224-61169246 TGCAAGGCCCAGAATGGCAAGGG - Intronic
1128336288 15:66787647-66787669 ACTGAGGCCCAGAGAGGGCAGGG + Intergenic
1128658371 15:69479153-69479175 ATCGAGGCCCAGAGAGGGCAAGG - Intergenic
1129034340 15:72640588-72640610 AGCAGGGCCCTGAGTGAGCATGG + Intergenic
1129215542 15:74096628-74096650 AGCAGGGCCCTGAGTGAGCATGG - Intergenic
1129391880 15:75224832-75224854 AGCAGGGCCCTGAGTGAGCATGG + Intergenic
1129458160 15:75686727-75686749 AGTAAGGCCAAGAGCGGGCAAGG + Intronic
1129472495 15:75763330-75763352 AGCAGGGCCCTGAATGAGCATGG - Intergenic
1129657351 15:77533146-77533168 ACCAAGGCTCAGAGGCGGCAAGG - Intergenic
1129725626 15:77900155-77900177 AGTAAGGCCAAGAGCGGGCAAGG - Intergenic
1129732679 15:77940957-77940979 AGCAGGGCCCTGAGTGAGCATGG - Intergenic
1130059133 15:80557184-80557206 AGGAAGGAGCAGAGTGTGCAGGG - Intronic
1130273654 15:82465347-82465369 AGTAAGGCTGAGAGCGGGCAAGG - Intergenic
1130295874 15:82647044-82647066 AGCACAGCCCAGAGTGGGCTCGG + Intronic
1130393655 15:83482049-83482071 GGCAAGACCCAGTGTTGGCAAGG - Intronic
1130466002 15:84192718-84192740 AGTAAGGCTGAGAGCGGGCAAGG - Intergenic
1130486687 15:84402082-84402104 AGTAAGGCTGAGAGCGGGCAAGG + Intergenic
1130498261 15:84480818-84480840 AGTAAGGCTGAGAGCGGGCAAGG + Intergenic
1130541084 15:84821262-84821284 GGCGAGGCCTAGAGAGGGCAGGG + Intronic
1130588294 15:85197314-85197336 AGTAAGGCTGAGAGCGGGCAAGG - Intergenic
1130657082 15:85799209-85799231 GGCAAGGCCCTGAGTGGGAGTGG - Intergenic
1130907268 15:88249527-88249549 CCAAGGGCCCAGAGTGGGCAGGG - Intronic
1132381471 15:101369435-101369457 AAGTGGGCCCAGAGTGGGCAAGG + Intronic
1132458818 16:39268-39290 AGAAGGGCCCAGAGTGACCATGG - Intergenic
1132639583 16:971467-971489 AGCAAGGGACAGAGTAGGCAGGG + Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1132949165 16:2550940-2550962 GCCAAGGACCAGCGTGGGCAGGG + Intronic
1132965423 16:2651188-2651210 GCCAAGGACCAGCGTGGGCAGGG - Intergenic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1133370316 16:5241162-5241184 AGCAACCCCAAGACTGGGCAGGG - Intergenic
1134093814 16:11405710-11405732 AGGAAGCCCCATAATGGGCAGGG - Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1135738959 16:24957069-24957091 AGCATGGAGCAGAGTGGGCCAGG + Intronic
1136019011 16:27428232-27428254 TACAAGGCTCAGAGAGGGCAAGG + Intronic
1137271317 16:46904128-46904150 AGCACAGCCCGCAGTGGGCAAGG + Intronic
1138153692 16:54683453-54683475 AGAAAGGAGCAGAGTGGGAAGGG - Intergenic
1138201979 16:55095804-55095826 AGCAAGTCACATAGAGGGCACGG - Intergenic
1138313604 16:56049513-56049535 AACAAGCCTCAGAGGGGGCATGG - Intergenic
1138415896 16:56871166-56871188 CACATGGCCCAGGGTGGGCATGG + Intronic
1138429995 16:56962546-56962568 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138515942 16:57535741-57535763 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1139006045 16:62572741-62572763 AGCAAGGAGCAGAGATGGCAAGG + Intergenic
1139308189 16:66005943-66005965 TCAAAGGCCCAGAGTGGGTAAGG + Intergenic
1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG + Intronic
1139504338 16:67391602-67391624 AGCAAGAGCCAGTCTGGGCACGG + Exonic
1140091064 16:71839322-71839344 AACAATGCCCAGGATGGGCACGG - Intergenic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141955243 16:87366489-87366511 GGAAACGCCCAGAGTGGGAAGGG + Intronic
1141980606 16:87547740-87547762 AGCAGAGAACAGAGTGGGCAGGG + Intergenic
1142010694 16:87712338-87712360 AGCCACGCCCACACTGGGCATGG - Intronic
1142466201 17:138817-138839 AGCAAGGCCCTCAGTGGGGGGGG - Intronic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1143091893 17:4453832-4453854 AGCAAGGCCCAGATTGGTTATGG + Intronic
1143306002 17:5947180-5947202 ATGAAGCCCCAGAGTGTGCATGG + Intronic
1143328522 17:6117558-6117580 ACTAAGGCACAGAGTGAGCATGG - Intronic
1143350633 17:6285623-6285645 GGCCAGGCCCAGAATTGGCATGG + Intergenic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1144739162 17:17571617-17571639 AGAAAGGCACACAGTGGGCCTGG + Intronic
1145252974 17:21306414-21306436 TGCCAGGCCCTGAGAGGGCACGG - Intronic
1145323601 17:21781502-21781524 TGCCAGGCCCCGAGAGGGCATGG + Intergenic
1145783791 17:27581175-27581197 AGCAAGAGCGAGAGGGGGCAGGG + Intronic
1146467788 17:33100303-33100325 AGAACAGCCCAGAGTGTGCAAGG - Intronic
1146925203 17:36739791-36739813 AGAAAAGCCCAGAGTGAGCCGGG - Intergenic
1147215010 17:38893916-38893938 AGGCAGGCCCAGAAGGGGCATGG - Intronic
1147543040 17:41377171-41377193 AAGAAGACCCAGAGTGTGCAGGG + Intronic
1147606628 17:41777350-41777372 AGCCAGGGACAGAGTGGGGAAGG - Intronic
1148219583 17:45852044-45852066 AGGAAAGCCCAGAGAGGGCCAGG + Intergenic
1148556604 17:48582255-48582277 AGAAAGGCCCAGAGGGGGCGCGG + Intronic
1149685869 17:58534367-58534389 ACAGAGGCCCAGAGAGGGCAAGG - Intronic
1150460516 17:65346385-65346407 AGCACTGCCCAGGGTGGGCCAGG + Intergenic
1150625713 17:66839897-66839919 AGCAAGGCCCAGAAGGGTTAAGG + Intronic
1150871995 17:68922626-68922648 AGCAAGGCCAAGAGATGACATGG + Intronic
1151438752 17:74114811-74114833 TGCAAGGCGCTGAGTAGGCAAGG + Intergenic
1151447225 17:74175213-74175235 AGCAAGGGCCAGCGTGCTCAAGG - Intergenic
1151801288 17:76381426-76381448 AGCAAGGCCCACCGTGGGCCTGG - Intronic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152074757 17:78152045-78152067 AGCCAAGCCCAGGCTGGGCACGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152305772 17:79519429-79519451 AGCCAGGACCAGGGTGGGTACGG + Intergenic
1152530596 17:80916473-80916495 AGCCAGGCGCAGAGTGGTGAGGG - Intronic
1152537907 17:80961051-80961073 AGCAAAGCAAAGGGTGGGCAGGG + Intronic
1152577593 17:81149632-81149654 AGCCAAGCCCAGGGTGGGCTGGG - Intronic
1152743406 17:82028496-82028518 ATCCAGGCCGAGGGTGGGCACGG + Exonic
1153091233 18:1346313-1346335 ATTAAGGCCCAGAGTTGGGAAGG - Intergenic
1153427850 18:4986812-4986834 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1153738720 18:8100094-8100116 AGCAAGGCAGAGAGTGAGGAGGG + Intronic
1155888171 18:31233737-31233759 AGCATGGGCCAGATTGGACAAGG + Intergenic
1156447868 18:37250341-37250363 AGCAAGGTCCTGAGTGGGGTGGG - Intronic
1156505707 18:37590239-37590261 AGAAAAGCCCAGAGTTGGCCAGG - Intergenic
1156872985 18:41969107-41969129 AACAAGGTACAGACTGGGCATGG - Intronic
1157006300 18:43588967-43588989 AGCCAGGCACAGAGTGACCAGGG + Intergenic
1157237483 18:45978280-45978302 AGGAAGCACCAGAGTGGCCAAGG - Intergenic
1157964242 18:52190197-52190219 ACTGAGGCCCAGAGAGGGCAAGG - Intergenic
1160298583 18:77658746-77658768 AGGAAGGCCCAGTGTGAGGAGGG + Intergenic
1160613591 18:80108127-80108149 CGGAAGGCCCAGCCTGGGCACGG + Intergenic
1160804949 19:988525-988547 AGCGAGGCCCAGAGAGGGCATGG + Intronic
1161016633 19:1986715-1986737 GGCAAGGCCCCGACTGGGCCAGG + Intronic
1161162461 19:2768832-2768854 AGCTAAGCCCAGAGAGGGCAGGG - Intronic
1161205999 19:3041841-3041863 AGCCAGGCCCAGAGAGGCCTAGG + Intronic
1161272630 19:3398473-3398495 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1161495684 19:4584569-4584591 AGCTCGGCCCAGAGAGGGCCAGG - Intergenic
1161768015 19:6217426-6217448 AGCCTGCCCCAGAGTGGGGAGGG - Intronic
1162487847 19:10972655-10972677 GCAAAGGCCAAGAGTGGGCAGGG - Intronic
1163033776 19:14560444-14560466 AGCAGGGCCCTGGGCGGGCACGG - Intronic
1163124223 19:15236031-15236053 AGAAAGTGCCTGAGTGGGCATGG + Exonic
1163270288 19:16248850-16248872 AAACAGGCCCAGAGAGGGCAAGG - Intergenic
1163689456 19:18730729-18730751 ATAAGGGCCCAGAGGGGGCAGGG - Intronic
1163722106 19:18903236-18903258 AGCCTGTCCCAGAGTGGGGACGG - Intronic
1163848700 19:19651656-19651678 AGCCTGGCCCACAGTGGGGAAGG - Intronic
1164052363 19:21594248-21594270 CACAATGCCCAGTGTGGGCAGGG - Intergenic
1164181638 19:22824199-22824221 AACAATGCCCACTGTGGGCAAGG - Intergenic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1165803621 19:38567424-38567446 AGAAAGACTCAGAGTAGGCATGG - Intronic
1166651377 19:44577682-44577704 AATAATGCCCAGTGTGGGCAAGG + Intergenic
1166666388 19:44682872-44682894 AACAAGGCCCAGAGAGGGACAGG + Intronic
1166931806 19:46305522-46305544 AGGAAGACCCAGAATGGTCAGGG + Intronic
1166996507 19:46722101-46722123 GGCGAGGCCCAGAGTGGGAGGGG - Intronic
1167035513 19:46993037-46993059 AGCCAGGCCCCGTGTGGACAGGG + Intronic
1167308087 19:48720255-48720277 AGAAAGGTCCAGAGGGGGCTGGG + Intergenic
1167612246 19:50513166-50513188 ACCAAGGCCCAGAGAGGGTCAGG + Intronic
1168269979 19:55244513-55244535 AGCACAGGCCAGGGTGGGCAGGG + Intronic
1202712236 1_KI270714v1_random:24955-24977 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
1202712252 1_KI270714v1_random:25010-25032 AGGCAGGCCCAGATTGGGGAAGG + Intergenic
925346722 2:3176851-3176873 AGGAAGGCCCAGAGGGGAGAAGG + Intergenic
925656474 2:6155411-6155433 TGCAAGGACAAGAGTTGGCAGGG + Intergenic
926188031 2:10706999-10707021 AGCCAGGCAGGGAGTGGGCACGG + Intergenic
926329043 2:11809917-11809939 AACAAAGCTCAGAGTGGGGAAGG - Intronic
926889845 2:17629644-17629666 AGCAAGGCCCAGGCATGGCAGGG - Intronic
926972788 2:18483773-18483795 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
927482961 2:23468855-23468877 AGCAGAGCCCAGAGAGAGCAGGG - Intronic
927670413 2:25064143-25064165 AGCCAGGGCCAGGGTGGTCACGG - Intronic
927775390 2:25898979-25899001 AGGAAGGCCCCCACTGGGCATGG + Intergenic
927879628 2:26681459-26681481 ACAGAGGCCCAGAGTGGGGAAGG - Intergenic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
928038638 2:27851306-27851328 AACAAGGGCCAGAGTAGGGAAGG - Intronic
928366299 2:30705937-30705959 TGCAAAGCCCACAGTGGGCTCGG + Intergenic
928406261 2:31017320-31017342 AGCAATGCCTATTGTGGGCAAGG - Intronic
929588585 2:43131156-43131178 AGCCAGGCTCACTGTGGGCAGGG + Intergenic
929883786 2:45860715-45860737 AGCACTGGCCAAAGTGGGCAGGG - Intronic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
932212673 2:69945435-69945457 TGCATGGAACAGAGTGGGCAGGG - Intergenic
932345538 2:70993050-70993072 AGCCATGCCCAGAGTGCACATGG + Intronic
932463778 2:71899939-71899961 AGCATGGCCAAGAGTGGTCCTGG + Intergenic
934054220 2:88238597-88238619 GGGAAGGCCCAGAGAGGGTAAGG + Intergenic
935072153 2:99704503-99704525 CCCAAGACCAAGAGTGGGCAAGG - Intronic
937087116 2:119178824-119178846 AGCAGGGCCCAGGGTGGGCAGGG - Intergenic
937737952 2:125314072-125314094 AGCCAGGCACAGAGTGGCAAGGG - Intergenic
940193538 2:151067533-151067555 GCCAAGGCACAGATTGGGCATGG + Intergenic
940413674 2:153395483-153395505 AGCAAGAAACAGAGTGGGAAGGG - Intergenic
941164974 2:162074444-162074466 ACCGAGACCCAGAGAGGGCAGGG + Exonic
944695554 2:202197276-202197298 AGCAAGTCCCAAAGAGGGAAAGG + Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946418168 2:219550953-219550975 ACCAAGGCCCAGAAAGGGTAGGG - Intronic
946611361 2:221461631-221461653 AACAAGGCCGAGAGGGGGAATGG + Intronic
946845202 2:223852788-223852810 ACCAAGACCCTGAGTGGGGAAGG - Intergenic
947064204 2:226201883-226201905 AGCAATTTCCAGATTGGGCAAGG - Intergenic
947771329 2:232672637-232672659 ACCGAGGCTCAGAGTGGACAGGG - Intronic
947833165 2:233156225-233156247 GACAAGGCCAAGACTGGGCAGGG + Intronic
947912672 2:233811683-233811705 AGCAGGGCCCAAAGTGGGCCTGG - Intronic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
948334804 2:237199721-237199743 AGCCAGGCACAGAGTGGCAAAGG + Intergenic
948622514 2:239245337-239245359 AGTGAGGCGGAGAGTGGGCAGGG + Intronic
948844696 2:240677469-240677491 AGCTAGGACCAGTGTGGGCCTGG - Intronic
948849164 2:240697410-240697432 AGCTAGGACCAGTGTGGGCCTGG + Intronic
948917273 2:241040670-241040692 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
948948352 2:241233263-241233285 GGCAGGGCCCAGAGAGGGGATGG + Intronic
1169138155 20:3210001-3210023 AGCAGGACCCAGAGAGGGCGTGG + Intronic
1170478530 20:16742343-16742365 AGCATGGCCAGGACTGGGCATGG - Exonic
1170688161 20:18587897-18587919 CGCCAGGCCGAGAGTGGGCGTGG + Exonic
1171286130 20:23939212-23939234 AGCCAGGTGCAGAGTGGTCAGGG - Intergenic
1171849185 20:30295969-30295991 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1172030991 20:31981981-31982003 AGCCAGGCCCAGCTTGGGAAGGG - Intronic
1172130269 20:32650584-32650606 AGGGATGCCCAGAATGGGCACGG - Intergenic
1172244686 20:33437872-33437894 ACCGAGGCCCACAGAGGGCAAGG + Intronic
1172750139 20:37245053-37245075 ACCAAGGCCCAGAGAGGTAAAGG - Intergenic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1174264378 20:49320613-49320635 AGCAAGGCTCAGAGAGGAGAGGG + Intergenic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174443874 20:50577468-50577490 AGCAAGGCCCTGAGAGGGAAAGG - Intronic
1174483712 20:50848521-50848543 AGCAGGGACCAGATTGTGCAGGG + Intronic
1174514019 20:51077309-51077331 AGCAAGGCACAGAGAGGTTAAGG + Intergenic
1175776788 20:61658782-61658804 AGCAACACCCACAGTGGACATGG + Intronic
1175944830 20:62553814-62553836 AGCCAAGCCCAGAGAGGGCTGGG - Intronic
1175975320 20:62707953-62707975 TGCAGGGCCCTGAGTGGGGAGGG + Intergenic
1177404449 21:20646673-20646695 AGCCAGGCACAGAGTGGAGAGGG - Intergenic
1177875278 21:26625145-26625167 AGCCAGGCGCAGAGTGGCGAGGG + Intergenic
1178210561 21:30526664-30526686 AGCAAGGACTACAGTGGACATGG - Intergenic
1178251347 21:31006350-31006372 AGCAAGACCTAGAGAGGACAGGG + Intergenic
1178397998 21:32259488-32259510 AGGAAGGTCCAGAGTAGGCTAGG - Intergenic
1178840276 21:36132982-36133004 AGCAAGGGCCAGGGTGGGGCTGG + Intergenic
1179459419 21:41523640-41523662 AGCCAGGTCCAGAGTAGGAAGGG + Intronic
1179722276 21:43322576-43322598 AGCAAGACCCAGGATGGGCCTGG + Intergenic
1179893922 21:44351008-44351030 AGCAACCTCCAGAGAGGGCAGGG + Intronic
1180074538 21:45455983-45456005 TGGAAGGCCCAGCGAGGGCAAGG - Exonic
1180800446 22:18629441-18629463 AGTGAGGCCCAGAGTGGGTCAGG + Intergenic
1180851681 22:19024998-19025020 AGTGAGGCCCAGAGTGGGTCAGG + Intergenic
1180998333 22:19976487-19976509 GGCAGAGCCAAGAGTGGGCAGGG - Intronic
1181221273 22:21365821-21365843 AGTGAGGCCCAGAGTGGGTCAGG - Intergenic
1181440749 22:22934139-22934161 GGCAGGGCCCAGAGAGAGCAAGG + Intergenic
1181540202 22:23568954-23568976 ACCAAGGCACAGAGAAGGCAAGG - Intergenic
1181646730 22:24235395-24235417 ACCAAGGCCCAAAGAGGGAATGG + Intronic
1181814982 22:25430701-25430723 AACAGGGCCCAGAGGGAGCAAGG + Intergenic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182102679 22:27669165-27669187 AGCAAGTGCCAGAGAGGGCTTGG + Intergenic
1182453455 22:30434646-30434668 ACCAAGGCCCAGAAAGGGAAAGG - Intergenic
1182755172 22:32673381-32673403 ATCAAGACCCACAGTGGGGAGGG - Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183335901 22:37245658-37245680 AGGAAGCCCCAGGGTGGTCACGG - Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183387061 22:37520855-37520877 AGCAGAGCTCAGAGAGGGCAAGG + Intergenic
1183479430 22:38055276-38055298 AAGAAGGGCCAGAGTGGGTAGGG + Intergenic
1183490334 22:38112365-38112387 AGCTAGGACCAGGGTGGGCTTGG + Intronic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1183985451 22:41567612-41567634 GGCAGGGCCCAGAGAGGGAAAGG + Intronic
1184245607 22:43234465-43234487 AGACAGGCCCAGATGGGGCAGGG - Intronic
1184271294 22:43385772-43385794 AGCAAGGCTCAGAGGAGGAAGGG - Intergenic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184802329 22:46769135-46769157 AGAAAGGCCCAAATTGAGCATGG + Intronic
1185172119 22:49300170-49300192 AGAGAGTCCCAGAGGGGGCAAGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185331274 22:50253057-50253079 TGCATGGCCCAGAGCAGGCAGGG + Exonic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
1185422074 22:50740347-50740369 ACCAAGGCCCAGAGAGTGGAAGG - Intronic
950037056 3:9893841-9893863 CACAAGGCACAGTGTGGGCAGGG - Exonic
950109369 3:10408666-10408688 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
950148126 3:10666268-10666290 AGAGATGACCAGAGTGGGCACGG + Intronic
950425660 3:12923616-12923638 ACCAAGGCTCAGAGTGGGAGGGG - Intronic
950527961 3:13535727-13535749 AGCAAGCCCGAGAATGGGCAGGG - Intergenic
952818085 3:37462900-37462922 AGGAAGGGTCAGAGTGGCCAGGG + Intronic
952883873 3:38001297-38001319 CACAAGGCCCAGAATGGGCCTGG + Intronic
953603175 3:44387644-44387666 AGCCAGGCACAGAGTGGCAAGGG - Intronic
954109153 3:48424591-48424613 AGCTGGGCCCAGAGCAGGCATGG + Exonic
954275422 3:49538886-49538908 ACTGAGGCCCAGAGAGGGCAAGG + Intergenic
954412451 3:50376732-50376754 TGCTTGGCCCTGAGTGGGCAGGG - Intronic
954464583 3:50647001-50647023 ACCAAGGCTCAGGGTGGGGAAGG - Intronic
954575151 3:51671703-51671725 GGCAAGGCCCGGGGTGAGCAGGG + Exonic
954611809 3:51948277-51948299 AGCAAGGGCCAGGGTGGCCCAGG - Intronic
955581921 3:60432264-60432286 ATAAAGGCCCAGACTAGGCATGG - Intronic
956385834 3:68718388-68718410 AGCAATGGCTAGAGTGGGGAAGG + Intergenic
956712110 3:72048131-72048153 AGCAAGGATCAGGCTGGGCATGG - Intergenic
957602478 3:82355922-82355944 AGCAAGGAGCACAGTGTGCATGG - Intergenic
957732068 3:84151536-84151558 CACCAGGCCCTGAGTGGGCAGGG + Intergenic
961131578 3:124472397-124472419 AGAAGGGCCCAGGCTGGGCACGG + Intronic
961513748 3:127420221-127420243 AGCAAGGACCAGAGGGCTCAGGG - Intergenic
961660901 3:128468327-128468349 AGCGAGGCCCAGAGAGGGCAGGG + Intergenic
961745675 3:129062206-129062228 AGCCAGGCCCAGCGCGGCCACGG - Exonic
961872925 3:130001724-130001746 AGCAACCCCAAGACTGGGCAGGG + Intergenic
963721783 3:148869720-148869742 CCCAGGGCCCAGACTGGGCATGG - Intronic
965709852 3:171546201-171546223 ACCAAGTCCCAGAGAGGCCAAGG + Intergenic
966824355 3:183951577-183951599 AGCAGAGCACAGAGTGGTCAGGG + Intronic
968295582 3:197574009-197574031 AGCAAGCACCTGAGTGGCCATGG - Intergenic
968424941 4:517028-517050 AGCAGGGGCCAGAGTGGCAAGGG + Intronic
968811443 4:2801275-2801297 AGCGTGGCCCAGAGGGGGCCTGG - Intronic
968832577 4:2940735-2940757 AGCACGGCACAGTGTGGGCCAGG + Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968900317 4:3428182-3428204 AGCAGGGCACAGGGTGGGCCAGG - Intronic
968980660 4:3847691-3847713 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
969016227 4:4106206-4106228 AGCAACCCCAAGACTGGGCAGGG + Intergenic
969350198 4:6593884-6593906 ACCAAGGCCCAGAGAGGTTAAGG + Intronic
969354064 4:6614813-6614835 AGCAATGACCAAGGTGGGCAAGG + Intronic
969737716 4:9002116-9002138 AGCAACCCCAAGACTGGGCAGGG - Intergenic
969796919 4:9533677-9533699 AGCAACCCCAAGACTGGGCAGGG - Intergenic
970455440 4:16219129-16219151 ACCAAGGCCCAGAGAGGCTAAGG + Intronic
972324888 4:38006044-38006066 AGCAGGGAGCAGAGAGGGCATGG + Intronic
972788320 4:42347289-42347311 AGCCAGGCCCGGAGTGGTGAAGG - Intergenic
973583218 4:52365079-52365101 ACCAAGGCCGAGCGTAGGCATGG + Intergenic
974420271 4:61663519-61663541 AGCCAGGCGCAGAGTGGTGAGGG - Intronic
974625253 4:64418191-64418213 AGCAAGGCTCAGATTCGGGAAGG - Intergenic
982111333 4:152058344-152058366 AGAAAAGCCCAGGTTGGGCATGG - Intergenic
983034373 4:162844608-162844630 AGCAAGGACCAGAAAGGGAAGGG - Intergenic
984095227 4:175426146-175426168 AGCAAGGCTAAGAGTTGGCATGG - Intergenic
984221517 4:176983522-176983544 AAAAAGGCACAGAGTGGGCCTGG + Intergenic
984763939 4:183385195-183385217 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
984865932 4:184280847-184280869 AGCTAGGCCCTGATTGGCCAAGG + Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985866392 5:2517630-2517652 AGAAAGGCCCAGTGTGGCCGGGG - Intergenic
985986781 5:3522671-3522693 ACCAAGGCCAGGAATGGGCAGGG + Intergenic
986195499 5:5533726-5533748 ACAAAGGCCCACAGTGTGCAGGG - Intergenic
987843930 5:23257216-23257238 AGTAAGGCTCAGAGTAGGAAAGG + Intergenic
988073363 5:26323991-26324013 AGCCAGGCACAGAGTGGCGAAGG + Intergenic
988807101 5:34750739-34750761 AGCAAGTCCCAGAATGGCCCCGG + Intronic
988884031 5:35535497-35535519 AGCAAAGCCTAGGCTGGGCATGG - Intergenic
989465479 5:41750080-41750102 AGCAAGTCTAAGAGTGGGGAAGG - Intronic
989520796 5:42397421-42397443 AGCCAGGCACAGAGTGGTGAAGG - Intergenic
989634215 5:43516937-43516959 AGCAAGTTCCAGAGTAGGAATGG - Intergenic
989732600 5:44665494-44665516 AGCCAGGCCCAGAGCGGTGAGGG - Intergenic
989762993 5:45042586-45042608 AACAAGGACCACAGGGGGCACGG + Intergenic
990062280 5:51666823-51666845 AACAAGTCCCAGGCTGGGCATGG + Intergenic
992086778 5:73284622-73284644 AGCCAGCTCCAGACTGGGCAGGG + Intergenic
992282860 5:75200184-75200206 AGCTTGGCTCAGAGGGGGCAGGG - Intronic
992668611 5:79036166-79036188 TGCATGGCACATAGTGGGCAAGG + Intronic
994451976 5:99955160-99955182 AGCCAGGCACAGAGTGGACAGGG + Intergenic
996871375 5:128197249-128197271 AGCAAGGCTCAGGGGGGCCAAGG - Intergenic
997212167 5:132083245-132083267 CCCAAGGCCCAGAGAGGGCAGGG + Intergenic
997354420 5:133253291-133253313 TGCTAGGCCCCGAGTGAGCAGGG + Intronic
997598555 5:135123897-135123919 ACCAAGGCCCAGAGAGGTGAAGG + Intronic
999195063 5:149776280-149776302 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
999202077 5:149823686-149823708 AGCAGTGGCCAGCGTGGGCAGGG + Intronic
999241791 5:150132170-150132192 AACAAGGCCCAGGGAGGGGAAGG + Intronic
999255091 5:150205637-150205659 AGGAAGGCTGAGAGTGGACAGGG - Intronic
999440520 5:151597247-151597269 GCCAAGCCCCTGAGTGGGCAAGG - Intergenic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
1001121558 5:168985137-168985159 TGCAAAGCCCAGGGTGGCCACGG - Intronic
1001579946 5:172791612-172791634 AGCAAGGCCCAGTGAGGGGCAGG + Intergenic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1002083012 5:176748611-176748633 GGCAAGGTCCAGAGAGGGGAAGG - Intergenic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1003007779 6:2397747-2397769 AGCAAGGGCAGGAGTGGTCATGG - Intergenic
1004338934 6:14790015-14790037 GGAAAGGCCCAGAGTGCTCAGGG + Intergenic
1004572097 6:16856683-16856705 AGCAAGACCCAGAGTGGTTAAGG + Intergenic
1005379375 6:25217933-25217955 AGCAGGGCTCAGAGTTGGGACGG - Intergenic
1005923025 6:30417588-30417610 AGAAAGGCTCAGGGAGGGCAAGG - Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006401631 6:33821186-33821208 ACCCAGGCCCTGAGTGGGCTTGG + Intergenic
1006460131 6:34153270-34153292 CGCAGGGCCCAGAGAGGCCAGGG + Intronic
1006677337 6:35773893-35773915 ACCGAGGCCCAGAGAAGGCAGGG - Intergenic
1006917135 6:37601976-37601998 AGCTGGGCCAAGAGTGAGCAGGG + Intergenic
1007077110 6:39075003-39075025 ACCAAGGCCCAGAGCTGGCAGGG + Intronic
1007222513 6:40290334-40290356 ATCAAGGCCCAGAGAGAGGATGG + Intergenic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1007461894 6:42025256-42025278 AGCAAGGCCAAGAGGGGCCCAGG + Intronic
1007670410 6:43548180-43548202 AGCTAGGCCCAGGGTGGGGTAGG - Intronic
1007751917 6:44076205-44076227 AGCAAGACCCAAAGTGGACTAGG + Intergenic
1009195369 6:60678327-60678349 AGGAAGGAGAAGAGTGGGCAAGG + Intergenic
1009479958 6:64144477-64144499 AGTGAGGCCCAGAGTGTGCTTGG + Intronic
1010496672 6:76540851-76540873 AGAAAGGCCAAAAGGGGGCAGGG + Intergenic
1012163620 6:95920934-95920956 AGCAAAGCTCAGAGAAGGCAAGG - Intergenic
1012413738 6:98989714-98989736 AGCAAAGCCCAGAGGTGGGAAGG - Intergenic
1012935413 6:105362855-105362877 AGCAAGGGGCAGAGGAGGCAGGG + Intronic
1013822671 6:114174141-114174163 AGCAAAGCCCAGAGTATTCAAGG - Intronic
1015108486 6:129565460-129565482 AGCAAGGGCCAAAGTGAACAAGG - Intergenic
1015990786 6:138940454-138940476 AGAAAGGTCCAGGCTGGGCATGG + Intronic
1016335908 6:143004858-143004880 AGAAAGGCCCGGAGAGGGTAAGG + Intergenic
1016667222 6:146656184-146656206 AGCAAGGCCCAGTGGGTGGATGG - Intronic
1017396115 6:154002106-154002128 AGCCAGGCACAGAGTGGGGATGG + Intergenic
1017722516 6:157253781-157253803 AGAAGGGCCCAGAGGTGGCATGG - Intergenic
1018518639 6:164617259-164617281 AGCAAGACCCAGTATGGGAAGGG - Intergenic
1019206223 6:170364282-170364304 AACAAGGCCCACAGTGTGAAAGG - Intronic
1019603212 7:1895633-1895655 AACACGGCCCAGAGCAGGCATGG + Intronic
1019643404 7:2116503-2116525 AGCAAGACCCCAGGTGGGCAGGG + Intronic
1020007773 7:4791495-4791517 GGCAAGGCCCACGGTGGGCTTGG + Exonic
1020009081 7:4798750-4798772 AGCAGGGCCCAGGGTGGGCTCGG + Intronic
1020127947 7:5543519-5543541 AGCAAGGCCCTGTGTGGGTCAGG + Intronic
1020556229 7:9673760-9673782 TGCAAGTCCCAGTGTGGGCTTGG - Intergenic
1021280551 7:18711604-18711626 AGCAACCCCAAGTGTGGGCAGGG - Intronic
1021686125 7:23188077-23188099 AGGAACACCCAGAGTGGGCTTGG - Intronic
1022476060 7:30710669-30710691 AGTGAGGCCCAGAGAGGGGAAGG + Intronic
1022786275 7:33640751-33640773 AGCCAGGCACAGGGTGGGAAAGG - Intergenic
1022821507 7:33966431-33966453 AGAAAGGCCAAGAATGGGTATGG - Intronic
1023759680 7:43453004-43453026 AGCAAGGCCCAGATCATGCAGGG + Intronic
1024342132 7:48277222-48277244 AGGGAGGCCCACAGTAGGCAGGG + Intronic
1024544354 7:50504793-50504815 AGCAGGGCCCAGACTGCCCAAGG + Intronic
1025020001 7:55473228-55473250 ATCAAAGCCCCGAGAGGGCAGGG - Intronic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1026907408 7:74070548-74070570 AGGAAGGGCCAGAATGGGAATGG - Intergenic
1027050035 7:75016129-75016151 TGCCAGGCCCTGAGTGGGGAGGG - Intronic
1027179542 7:75928646-75928668 AGCAACGTCTAGTGTGGGCAGGG - Intronic
1027190251 7:75992339-75992361 AACAGGGCCCAGAGAGGGGAGGG + Intronic
1028692429 7:93668516-93668538 AGCAAGCCCCAGTGGGGTCATGG - Intronic
1028874600 7:95806954-95806976 AGAATGGCCCTGAGTGGGTATGG + Intronic
1029074899 7:97927878-97927900 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1029104636 7:98165333-98165355 ACCAAGGCCGAGAGAGGGGAAGG + Intronic
1029372283 7:100157623-100157645 TTCAAGGCCCAAGGTGGGCAGGG - Exonic
1029383003 7:100225539-100225561 TGCCAGGCCCTGAGTGGGGAGGG + Intronic
1029608877 7:101616053-101616075 ACCAAGGCCCAGAGAGGGGAAGG + Intronic
1029705335 7:102273004-102273026 AGTGAGGCCCAGAGAGGGAAAGG + Intronic
1030143558 7:106330214-106330236 ACCAAGGCCAAGAGAGGGGAAGG + Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031702049 7:124938376-124938398 AGCAAGGCACAGACTAAGCAAGG + Intergenic
1031902476 7:127426678-127426700 ATCAAGGCCCAGGTCGGGCATGG - Intronic
1032424043 7:131806307-131806329 AGCAAGCCCCAGGGTGAGCAGGG - Intergenic
1032768573 7:135024209-135024231 TACAAGGCCCAGAGCGGGCCTGG + Intronic
1033099853 7:138460639-138460661 AACGAGGCCGAGAGTCGGCAGGG + Exonic
1033351402 7:140565220-140565242 AGGGAGTCCCTGAGTGGGCAAGG + Intronic
1033423697 7:141224643-141224665 AGCCTGGCCCAGAGTTGGCTTGG - Intronic
1034101678 7:148456501-148456523 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1034980702 7:155474263-155474285 ACCAAGGCCCAGAGAGGAAAAGG - Intronic
1035520235 8:270472-270494 ACCAAGGCCCAGAGTCGGGAGGG + Intergenic
1036199226 8:6752974-6752996 ACCAAGGCCCAGCGTAGCCATGG - Intronic
1036242815 8:7093377-7093399 AGCAACCCCAAGACTGGGCAGGG - Intergenic
1036359499 8:8066855-8066877 AGCAACCCCAAGACTGGGCAGGG - Intergenic
1036637167 8:10559342-10559364 AGCAGGTGCCAGAGTGGCCAAGG + Intergenic
1036829914 8:12013767-12013789 AGCAACCCCAAGACTGGGCAGGG + Intronic
1036891457 8:12600097-12600119 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1036899008 8:12658059-12658081 AGCAACCCCAAGACTGGGCAGGG + Intergenic
1037343542 8:17873236-17873258 ATCTAGGCCCAGAATTGGCATGG - Intronic
1037605672 8:20435415-20435437 TGCAAGGCCTGGAGTGGGGACGG + Intergenic
1038479219 8:27890337-27890359 AGCAGGGCCCAGGGTGGGGCAGG + Intronic
1038558063 8:28542189-28542211 AGCAAGGCTAAAAGTGAGCATGG - Intronic
1038823854 8:30979008-30979030 AGTAAGGCCCAGAGTAGTAAAGG - Intergenic
1039268470 8:35854542-35854564 AGCGAGGCTGGGAGTGGGCATGG + Intergenic
1039457346 8:37716253-37716275 TGCCAGGCACAGACTGGGCATGG - Intergenic
1039931494 8:41994765-41994787 AGCAATGCCTAGGCTGGGCACGG + Intronic
1040594659 8:48825527-48825549 AGCAAGGCCAAGTGTGCCCAGGG - Intergenic
1041167075 8:55101717-55101739 AGGACGGCGGAGAGTGGGCACGG - Intergenic
1041274536 8:56143297-56143319 AGCCAGGCACAGAGTGGCAAGGG - Intergenic
1043180457 8:77082105-77082127 AGCCAGGCACAGAGTGGTGAGGG + Intergenic
1043798535 8:84578095-84578117 AGCCAGGCACAGAGTGGCAAGGG + Intronic
1044556451 8:93567629-93567651 AATAAAGCCCGGAGTGGGCATGG + Intergenic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1044953385 8:97455084-97455106 AGCAAGGGCCTGGGTGGGGAGGG + Intergenic
1048441160 8:134459970-134459992 AGAGAGGCCCAGAGAGGCCAAGG - Intergenic
1049207127 8:141368741-141368763 AGCAAAGCTGGGAGTGGGCAGGG + Intergenic
1049235438 8:141510216-141510238 AGCGAGGCTCAGAGAGGACAGGG - Intergenic
1049405397 8:142449946-142449968 GGCGAGGCCCAGAGCGGGCCGGG + Exonic
1049428224 8:142546986-142547008 ATCAGGGCTCAGAGTGGCCAAGG + Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1049636832 8:143693588-143693610 AGCAAAGCCCAGAGGAGGCCGGG - Intronic
1053268032 9:36730132-36730154 ACCAATGCCCAGAGAGGGGAAGG - Intergenic
1053479938 9:38408761-38408783 ACCAGGGCCCAGAGAGGGGAAGG + Intergenic
1053786906 9:41658688-41658710 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1054826364 9:69577824-69577846 AACAAGGCCCAGAGAGGTGAAGG + Intronic
1055890748 9:81121553-81121575 AGCCAGGCACAGAGTGGCGAGGG + Intergenic
1056320352 9:85429617-85429639 AGAATGGCCCAGAGTGGACCTGG + Intergenic
1056462287 9:86819300-86819322 AGCCAGGCACAGAGTGGTGAGGG - Intergenic
1056684947 9:88751906-88751928 GGCTGGGCCCAGGGTGGGCACGG + Intergenic
1056994319 9:91442535-91442557 AGCCAGGCGCAGAGTGGTGAGGG + Intergenic
1057584366 9:96316208-96316230 AGGATGGCCCAGGCTGGGCATGG + Intergenic
1057829900 9:98398427-98398449 AGCAAGACCCAGGTTGGGGATGG - Intronic
1057847900 9:98539520-98539542 ACTAAGGCCCAGAGAGGGAAGGG - Intronic
1057867960 9:98696341-98696363 AGCAATGCTGGGAGTGGGCAGGG + Intronic
1057935470 9:99234888-99234910 AGACAGGCCCAGAGAGGGGAAGG + Intergenic
1059157245 9:112001178-112001200 ACCAAGGCCGAGGGTTGGCATGG - Intergenic
1059664674 9:116435203-116435225 AACAAGGTCCAGAATGGGGATGG + Intronic
1059811127 9:117856796-117856818 CGCAAGGCTCAGAGTGGTGATGG - Intergenic
1060155313 9:121315871-121315893 ACCAAGGCACAGAGTGGTTAAGG - Intronic
1060519435 9:124285968-124285990 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1060554660 9:124502011-124502033 AGCCAGGCCCTGAGGGGGCCGGG - Intronic
1060662530 9:125412894-125412916 GGGAAGGCCCAGAGCAGGCAAGG - Intergenic
1061086199 9:128400206-128400228 ACTGAAGCCCAGAGTGGGCAAGG - Intergenic
1061195188 9:129103521-129103543 ACAGAGGCCCAGAGTGGGGAAGG - Intronic
1061276356 9:129571187-129571209 ACCAAGGCACAGAGAGGGCAAGG - Intergenic
1061301650 9:129709168-129709190 ACCAAGGCCCAGAGGTGGGAAGG + Intronic
1061303910 9:129721936-129721958 AGCCAGGCCCAGGGTACGCATGG + Intronic
1061363043 9:130155845-130155867 AGCAAGGCCCAGAGAGGTTGAGG - Intergenic
1061488345 9:130931709-130931731 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1061502696 9:131012983-131013005 ACCAAGGCCCAGGGAGGCCACGG + Intronic
1061670942 9:132187940-132187962 ACCAAGGCACAGATAGGGCAAGG + Intronic
1062036671 9:134385572-134385594 AGCAAGGGCCACACTGAGCAGGG - Intronic
1185721705 X:2387801-2387823 AGCCAGCTCCAGAGTGTGCATGG + Intronic
1186235060 X:7498834-7498856 AGCAAGGCAAACAGTGAGCACGG + Intergenic
1186349315 X:8727328-8727350 TGCAGGGACCATAGTGGGCAGGG - Intronic
1186455092 X:9704377-9704399 AGCAAGGTACAGAGCAGGCAGGG + Intronic
1187010117 X:15270014-15270036 AGCAAAGCACAGAGCAGGCAGGG + Exonic
1190427317 X:50345542-50345564 AGGAAGGGAGAGAGTGGGCAAGG - Intronic
1192237072 X:69302769-69302791 AGCAGGGGCCTCAGTGGGCAAGG + Intergenic
1192315067 X:70044720-70044742 AGCAGGGCCCAGAGAGGAGAGGG - Intronic
1192427560 X:71090828-71090850 AACAAGGACCAGGTTGGGCATGG + Intergenic
1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG + Intergenic
1192503826 X:71669147-71669169 AGCAAGGGATAGAGAGGGCATGG - Intergenic
1192510191 X:71716823-71716845 AGCAAGGGACAGAGGAGGCATGG + Intronic
1192516506 X:71764730-71764752 AGCAAGGGACAGAGGAGGCATGG - Intronic
1192522588 X:71815191-71815213 AGCAAGGGATAGAGAGGGCATGG - Intergenic
1192529315 X:71871945-71871967 AGCAAGGGACAGAGGGGACATGG + Intergenic
1195221547 X:102748952-102748974 ACCAAGGCCAAGACTGGACAGGG + Exonic
1195614514 X:106901925-106901947 ACCAAAGCTCAGAGTGGGCAAGG - Intronic
1195674793 X:107499863-107499885 AGGCAGGCCCAGAGTTGGGAGGG - Intergenic
1196210383 X:112989400-112989422 AGCAAGTGACAGAGTAGGCAGGG + Intergenic
1196622128 X:117835718-117835740 AGGAAAGCCTAGAGTGGCCAGGG - Intergenic
1197127436 X:122963959-122963981 AGCAAGGAGAAGAATGGGCATGG + Intergenic
1197536389 X:127693346-127693368 AGCAACACCCAGTGTTGGCAAGG + Intergenic
1197907558 X:131442723-131442745 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1197911809 X:131491268-131491290 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1198051851 X:132958243-132958265 GGCCAGGCCCCGAGTGAGCAGGG + Exonic
1198762985 X:140053199-140053221 AGCAAAGAACAGTGTGGGCATGG + Intergenic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1199763857 X:150926424-150926446 AGCAAGTTCCAGAGCAGGCAGGG - Intergenic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic
1200765813 Y:7079839-7079861 AGCCAGGTGCAGAGTAGGCAGGG + Intronic
1201593045 Y:15636715-15636737 AGCCAGGCGCAGAGTGGTTAAGG + Intergenic
1201601352 Y:15731620-15731642 AGCAAGACAAAGAGTGAGCATGG + Intergenic
1202369211 Y:24185932-24185954 AGTAAGGCTGAGAGTGGGCAAGG + Intergenic
1202501574 Y:25484185-25484207 AGTAAGGCTGAGAGTGGGCAAGG - Intergenic