ID: 1185217368

View in Genome Browser
Species Human (GRCh38)
Location 22:49609145-49609167
Sequence GCACTTGGCCGCGTGTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185217368_1185217379 11 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217379 22:49609179-49609201 GTCCTCGGGAGCCGGTGGTGGGG No data
1185217368_1185217372 -4 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217372 22:49609164-49609186 GTGCACGCAGCCGGTGTCCTCGG No data
1185217368_1185217376 6 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217376 22:49609174-49609196 CCGGTGTCCTCGGGAGCCGGTGG No data
1185217368_1185217377 9 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217377 22:49609177-49609199 GTGTCCTCGGGAGCCGGTGGTGG No data
1185217368_1185217378 10 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217378 22:49609178-49609200 TGTCCTCGGGAGCCGGTGGTGGG No data
1185217368_1185217373 -3 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217373 22:49609165-49609187 TGCACGCAGCCGGTGTCCTCGGG No data
1185217368_1185217374 3 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217374 22:49609171-49609193 CAGCCGGTGTCCTCGGGAGCCGG No data
1185217368_1185217382 22 Left 1185217368 22:49609145-49609167 CCCAGGAACACGCGGCCAAGTGC No data
Right 1185217382 22:49609190-49609212 CCGGTGGTGGGGCTCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185217368 Original CRISPR GCACTTGGCCGCGTGTTCCT GGG (reversed) Intronic