ID: 1185218155

View in Genome Browser
Species Human (GRCh38)
Location 22:49615392-49615414
Sequence TCTCGCGTGACACACGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185218155_1185218161 4 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218161 22:49615419-49615441 TCCTGCACGTGGATCTGGACGGG No data
1185218155_1185218160 3 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218160 22:49615418-49615440 GTCCTGCACGTGGATCTGGACGG No data
1185218155_1185218163 5 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218163 22:49615420-49615442 CCTGCACGTGGATCTGGACGGGG No data
1185218155_1185218157 -7 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218157 22:49615408-49615430 CGCGAGACCAGTCCTGCACGTGG No data
1185218155_1185218158 -1 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218158 22:49615414-49615436 ACCAGTCCTGCACGTGGATCTGG No data
1185218155_1185218164 19 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218164 22:49615434-49615456 TGGACGGGGCAACTGCGCGAAGG No data
1185218155_1185218165 20 Left 1185218155 22:49615392-49615414 CCGGCCGCGTGTGTCACGCGAGA No data
Right 1185218165 22:49615435-49615457 GGACGGGGCAACTGCGCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185218155 Original CRISPR TCTCGCGTGACACACGCGGC CGG (reversed) Intronic