ID: 1185218717

View in Genome Browser
Species Human (GRCh38)
Location 22:49618113-49618135
Sequence CCTCCTGGTGGGTAGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185218717 Original CRISPR CCTCCTGGTGGGTAGGGCTT GGG (reversed) Intronic