ID: 1185219320

View in Genome Browser
Species Human (GRCh38)
Location 22:49621672-49621694
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185219320_1185219326 -6 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219326 22:49621689-49621711 ACCACACAGGTCAGCCACGGTGG No data
1185219320_1185219331 18 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219331 22:49621713-49621735 TGCCAGGTTCCCCAGACCAAGGG No data
1185219320_1185219328 2 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219328 22:49621697-49621719 GGTCAGCCACGGTGGATGCCAGG No data
1185219320_1185219333 26 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219333 22:49621721-49621743 TCCCCAGACCAAGGGCTGCCAGG No data
1185219320_1185219330 17 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219330 22:49621712-49621734 ATGCCAGGTTCCCCAGACCAAGG No data
1185219320_1185219325 -9 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185219320 Original CRISPR TGTGGTCGGCCGGCCGCTGT GGG (reversed) Intronic