ID: 1185219325

View in Genome Browser
Species Human (GRCh38)
Location 22:49621686-49621708
Sequence CCGACCACACAGGTCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185219320_1185219325 -9 Left 1185219320 22:49621672-49621694 CCCACAGCGGCCGGCCGACCACA No data
Right 1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG No data
1185219321_1185219325 -10 Left 1185219321 22:49621673-49621695 CCACAGCGGCCGGCCGACCACAC No data
Right 1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG No data
1185219319_1185219325 -8 Left 1185219319 22:49621671-49621693 CCCCACAGCGGCCGGCCGACCAC No data
Right 1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185219325 Original CRISPR CCGACCACACAGGTCAGCCA CGG Intronic