ID: 1185221825

View in Genome Browser
Species Human (GRCh38)
Location 22:49632928-49632950
Sequence AGACCCCAGGCCGTGCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185221825_1185221834 28 Left 1185221825 22:49632928-49632950 CCATTGAGCACGGCCTGGGGTCT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1185221834 22:49632979-49633001 GCAATCCAGCTGCACACAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 101
1185221825_1185221832 3 Left 1185221825 22:49632928-49632950 CCATTGAGCACGGCCTGGGGTCT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1185221832 22:49632954-49632976 GGGCTGTTTTCAGAACCGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 76
1185221825_1185221830 -1 Left 1185221825 22:49632928-49632950 CCATTGAGCACGGCCTGGGGTCT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1185221830 22:49632950-49632972 TGCGGGGCTGTTTTCAGAACCGG 0: 1
1: 0
2: 1
3: 1
4: 102
1185221825_1185221831 2 Left 1185221825 22:49632928-49632950 CCATTGAGCACGGCCTGGGGTCT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1185221831 22:49632953-49632975 GGGGCTGTTTTCAGAACCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185221825 Original CRISPR AGACCCCAGGCCGTGCTCAA TGG (reversed) Intronic
900210907 1:1455484-1455506 CGACCCCAGGACGTGCTGGAGGG + Exonic
900216730 1:1485803-1485825 CGACCCCAGGACGTGCTGGAGGG + Exonic
900894265 1:5472398-5472420 CGAACCCAGGCCCTGCTCATTGG + Intergenic
901012006 1:6207377-6207399 AGACACCAGACGGTGCTGAAGGG + Exonic
903369788 1:22827862-22827884 AGACCCTTGGCCTTGCTCCAGGG + Intronic
903690798 1:25171999-25172021 GGGCCCCAGGCCGGGCACAAGGG + Intergenic
904398473 1:30239762-30239784 AGAACCCAGGGCATGCTCACAGG - Intergenic
908530122 1:65026347-65026369 ATACCCCAGGCTGTGTTCAAAGG - Intergenic
908976453 1:69904833-69904855 AGACGCCAGGGCCTACTCAAGGG - Intronic
912471722 1:109911203-109911225 AGGGCCCAGTCCGTGCGCAAAGG - Intronic
917627322 1:176859495-176859517 AGACCCCTGGCCGGGCACAGTGG + Intronic
921265320 1:213416815-213416837 AGACCCCAGTCCCTCTTCAAGGG - Intergenic
921285114 1:213602518-213602540 AAACACCAGGCCGGGCGCAATGG - Intergenic
923084242 1:230690322-230690344 AGCCCACAGGCCGTCCACAAGGG - Intronic
924764465 1:247019554-247019576 AAACCCCAGGCCGGGCACCATGG + Intergenic
1062790829 10:304455-304477 AGACCACAGGCCATGATGAAGGG + Intronic
1064912828 10:20421605-20421627 AGACACCAGGCCCTACTTAACGG - Intergenic
1072119119 10:92390730-92390752 AGACCCCAGGCCGGGCTTGGTGG + Intergenic
1072613494 10:97034673-97034695 AGACCCGAGGCTGTGCACCAGGG - Intronic
1073952658 10:108829058-108829080 AGTCCCCAAGCTGTTCTCAAAGG + Intergenic
1076675867 10:132147491-132147513 GGAGCCCAGGCTGTGCCCAATGG - Intronic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076907151 10:133368486-133368508 AGAGCCCAGGCCCTTCTCACGGG + Intronic
1077391640 11:2303118-2303140 AGACCCGAGGCCCTGCCCAGGGG - Intronic
1079959658 11:26907446-26907468 AGACACCAGGGCTTACTCAAGGG - Intergenic
1080393746 11:31871475-31871497 AGACCCCAGGCTGTGCAGATGGG - Intronic
1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG + Intronic
1083623749 11:64061400-64061422 AGACCCCAGGCCGGCCTCCCAGG + Intronic
1083631094 11:64095905-64095927 AGAACCCAGGCTCTGCCCAAAGG - Intronic
1086303384 11:85453939-85453961 AGACACCAGGGCCTGCTTAAGGG - Intronic
1092170163 12:6369400-6369422 GGAGCCCAGGCTGTGCTCAGTGG - Intronic
1103337898 12:120203558-120203580 AGACCCCAGGCCAGGCACAGTGG - Intergenic
1104102058 12:125622061-125622083 ACACCCCAAGCCCTGCTGAAAGG - Intronic
1107657838 13:42610037-42610059 AGACCCCAGGCCGGGCGCGGTGG + Intergenic
1110378450 13:74821212-74821234 GGACCCCAGGCCTTGCTGATGGG + Intergenic
1110612180 13:77501258-77501280 AGACCACAGGCCGAGCGCAGTGG - Intergenic
1110837472 13:80101119-80101141 AGACCCCAAGCCATGGTCATAGG - Intergenic
1112111682 13:96306687-96306709 AGAACACAGGCCGTGCACACAGG - Intronic
1112494865 13:99896431-99896453 GGACCCCAGGGCGGGCGCAAGGG - Exonic
1113561890 13:111287714-111287736 GAACCCCAGGCTGTGCCCAAGGG + Intronic
1114619142 14:24084592-24084614 AGGCACCAGGCCCTGCTCCATGG - Intronic
1115673682 14:35645441-35645463 ATACCCCAGGCCGGGCGCAATGG + Intronic
1116802333 14:49455869-49455891 ACAACCCAGTCCATGCTCAATGG - Intergenic
1117306822 14:54485962-54485984 AGACCCCGGGCCGGGCACAGTGG + Intronic
1118630165 14:67695428-67695450 AGACCCCAGGCGGTGAGAAAGGG - Intronic
1119479407 14:74950290-74950312 AGAGGCCAAGCAGTGCTCAAGGG - Intronic
1121089588 14:91171815-91171837 AGGCACCAGGCCGTGCTCCATGG + Intronic
1121325279 14:93016196-93016218 ATACCTCAGGCCATGCTCAAAGG + Intronic
1122417253 14:101556347-101556369 AGAGCCCAGGCCGGGCTGGAGGG + Intergenic
1123044817 14:105506559-105506581 AGAGCCCAGGCCGGGCGCAGTGG - Intergenic
1123629667 15:22253024-22253046 AGACCCCAGGCCATTCCCACTGG + Intergenic
1124628092 15:31321194-31321216 AGACCCCAGGCAGGGCGCAGTGG - Intergenic
1125767205 15:42143836-42143858 GGAACCCAGGCCGTCCACAAAGG + Intronic
1126117547 15:45222321-45222343 CTACCCCAGGGCTTGCTCAATGG - Intergenic
1126731892 15:51691911-51691933 AGACCCCAGCTCCTGCTCAGGGG - Intronic
1127332839 15:57955610-57955632 TGACCCCAGGCTGTGCTCAGAGG + Intronic
1128288793 15:66460933-66460955 AGGCCCATGGCCGTGCTCCAGGG + Intronic
1129607536 15:77032174-77032196 AGACCCCGAGCCGCGCACAATGG + Intronic
1129765463 15:78162831-78162853 AGACTCCAGGCCGGGCGCAGAGG - Intronic
1129787985 15:78321985-78322007 AGACCCCAGGTCCTGCTCCCTGG + Intergenic
1132888218 16:2191756-2191778 AGGCCCCAGGCCTGGCTCCAAGG - Intronic
1132933273 16:2469261-2469283 AGACCCCAGTCCTGGCTCACAGG + Intergenic
1133678862 16:8101372-8101394 AGATCCCAAGCCCTGCTGAAGGG + Intergenic
1134177405 16:12018873-12018895 ATACCCCAGGCCGGGCTCAGTGG - Intronic
1135568212 16:23528388-23528410 AGGCCCCAGGCCGGGAACAATGG + Intronic
1139504614 16:67392737-67392759 AGAGCCCAGGCCGTGGTCACTGG - Intronic
1141611248 16:85182277-85182299 GGACCCCAGGGCGTGCAGAATGG + Intronic
1142104124 16:88292951-88292973 AGACCCCAGGGCCTCCCCAAGGG - Intergenic
1144952413 17:19001387-19001409 AGACCTCAGGGAGTCCTCAAGGG - Intronic
1146545653 17:33735716-33735738 TGATCCCAGGGAGTGCTCAATGG - Intronic
1148625896 17:49068728-49068750 AGAGCCCAGGCCATGCCCAAGGG + Intergenic
1149396783 17:56253448-56253470 AGAAGCCAGGCCGGGCGCAATGG + Intronic
1150002647 17:61451587-61451609 AGAGCCCAGGCCGGGCTGCAAGG - Intergenic
1150201432 17:63361734-63361756 AGACCTCAGGACCTGCTGAATGG - Intronic
1150211341 17:63443292-63443314 AGACACCAGGCCCTGACCAAAGG + Intronic
1150364429 17:64568712-64568734 AAAACCCAGGCCGGGCACAACGG + Intronic
1152640368 17:81446922-81446944 AGACCCAAGCCCGTGCGGAAGGG - Intronic
1153172224 18:2329178-2329200 AGACCACAGGCCGGGCGCAGTGG + Intergenic
1153881831 18:9427836-9427858 AGAAGCCAGGCAGTTCTCAAAGG + Intergenic
1157537694 18:48472088-48472110 CCACCCCAGGGCTTGCTCAATGG - Intergenic
1160704374 19:523190-523212 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704390 19:523255-523277 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704414 19:523350-523372 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704423 19:523384-523406 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704432 19:523415-523437 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704441 19:523449-523471 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704450 19:523483-523505 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704458 19:523514-523536 AGCCCCCGGCCCGTGCTCACTGG - Intergenic
1160704468 19:523548-523570 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704478 19:523582-523604 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704488 19:523616-523638 AGCCCCCGGCCCGTGCTCACCGG - Intergenic
1160704498 19:523650-523672 AGCCCCCAGCCCGTGCTCACCGG - Intergenic
1160957358 19:1699741-1699763 AGACCCCAGGCGGGGCTTAGGGG + Intergenic
1163312946 19:16525087-16525109 AGAACCCAGGCCGGGCTCCTCGG + Intronic
1164245638 19:23425981-23426003 TCACCCCAGGCCGGGCTCAGTGG - Intergenic
1165327182 19:35121002-35121024 ACTCCCCAGGCCCTGCCCAAAGG + Intronic
1165356143 19:35305294-35305316 AGACAGAAGGCCCTGCTCAAGGG - Intronic
1165493509 19:36139397-36139419 AGAAACCAGGCCGTGGCCAAAGG + Intergenic
1166251273 19:41572673-41572695 AGACCCCAGGCAGGGCTCAGTGG - Intronic
1167659125 19:50785682-50785704 AGGCCCGAGGCCGGGCGCAAGGG + Intergenic
925075224 2:1010798-1010820 TGACCCCAGGCAGGGCCCAAGGG + Intronic
925292313 2:2755967-2755989 AGTCCCCAGGACTTGCCCAAGGG - Intergenic
926418480 2:12674303-12674325 AGACCCAATGCCCTTCTCAACGG - Intergenic
927507741 2:23625585-23625607 AGACCCCAGGGAGTGTTGAATGG - Intronic
931716141 2:65030176-65030198 AGAGCCCAGGCCGTGTGCAGTGG + Intergenic
935668478 2:105535074-105535096 AGAGCCCAGTGGGTGCTCAAGGG - Intergenic
937099099 2:119254920-119254942 AGAGCCCAGGCAGTTCTCAAAGG - Intronic
938178411 2:129157497-129157519 ATACCACAGGCTGTGGTCAATGG + Intergenic
938564815 2:132509015-132509037 AGAGGCCAGGCTGTGCTGAAGGG + Intronic
938947363 2:136225263-136225285 GGACCCCAGGCCAGGCGCAATGG - Intergenic
940218212 2:151322991-151323013 AGACTCCAGGCCGGGCACAGTGG + Intergenic
944675603 2:202033044-202033066 AGACTCCAGGCCGTGCGCGCGGG + Intergenic
945099361 2:206250154-206250176 AGGCCCCAGGCTGTGCTCGGCGG - Intergenic
1169119268 20:3085375-3085397 AGTCCCCATGCCCTGCTCTATGG - Intergenic
1170463235 20:16598950-16598972 AGTCCCCAGGCCGGGCACAGCGG + Intergenic
1172275322 20:33676064-33676086 GGACCCCTGCCCTTGCTCAAGGG + Exonic
1172510557 20:35497975-35497997 AGACCCCAGGGCCTGCTGCAGGG - Exonic
1172968413 20:38855761-38855783 AGACTCCTGGCAGTGCTCCAAGG + Intronic
1172977482 20:38917954-38917976 CGACCCCTGGCCTTGCTCCAGGG - Intronic
1174525239 20:51165242-51165264 AAGCCCCAGGCTGTGATCAAAGG - Intergenic
1175543210 20:59761265-59761287 AGGCCCCAGGCAGTGGTTAAGGG - Intronic
1175721203 20:61288512-61288534 AGCCCCCAGCCCATGCTCAGGGG - Intronic
1175914605 20:62419828-62419850 AGACCCCATGCCATGCTGTAGGG + Intronic
1180091760 21:45537148-45537170 ACCCGCCAGGCCGTGCTCATCGG - Intronic
1181022540 22:20111213-20111235 AGGCACCAGGGTGTGCTCAAAGG + Exonic
1181165490 22:20980895-20980917 AGACCCCCTGCTGTCCTCAAGGG + Intronic
1183227590 22:36561161-36561183 AGAACCCAGGCCTTGCGCCATGG + Intergenic
1183549967 22:38476503-38476525 AGACTCCTGGCCGGGCGCAATGG - Intronic
1184041600 22:41947144-41947166 TGCCCCCAGGCCGCGCTCTAGGG - Exonic
1184651767 22:45922597-45922619 AGACCCCTGGCCTTGCTCTCTGG + Exonic
1184901011 22:47446436-47446458 AGGGCCCAGGCAGTGCTCAGAGG + Intergenic
1185136332 22:49075277-49075299 AAACACCAGGCTGTGGTCAAGGG + Intergenic
1185221825 22:49632928-49632950 AGACCCCAGGCCGTGCTCAATGG - Intronic
950001980 3:9663798-9663820 AGACTCCAGGCCGTGCGCGGTGG - Intronic
953570314 3:44066147-44066169 AGAGCCCAGGCCTGGGTCAAAGG + Intergenic
953607446 3:44420922-44420944 AGGCCCCAGGCTGTGCCCCAGGG + Intergenic
954267789 3:49483593-49483615 AGAATCCAGTCCCTGCTCAAGGG - Intronic
954458621 3:50613204-50613226 AGACCCCTGGCCTTGTTGAAGGG + Intronic
956311798 3:67889035-67889057 AGACCACAGGCCGGGCACAGTGG + Intergenic
956748185 3:72326040-72326062 AGATCCCAGCCCATACTCAAGGG + Intergenic
957561859 3:81832484-81832506 AGACCCCAGACCGGGCGCAGTGG + Intergenic
960759435 3:121055978-121056000 AGACCCCAGGCCAAGCACAGTGG - Intronic
961184503 3:124902830-124902852 AGACCCCAGGCCAGGCGCAGTGG + Intergenic
968861656 4:3176312-3176334 AGACCCCAGGCCGGGCGCGGTGG - Intronic
969353720 4:6613144-6613166 ATACCCCAGGCCATGCTGATTGG - Intronic
973758032 4:54094086-54094108 ATACCCCAGGCTGCGCGCAAGGG - Intronic
973815883 4:54618686-54618708 AGACCCCAGGCCAGGCACAGTGG + Intergenic
977242155 4:94585882-94585904 AGACCCCAGGCCGGGCACAGTGG + Intronic
977723739 4:100270310-100270332 AGAAGCTTGGCCGTGCTCAAAGG + Intergenic
979287495 4:118942350-118942372 AGACCCCATGCCGGGCACAGGGG - Intronic
985592889 5:774557-774579 AGACCCCAGGCCGTAGTTACAGG - Intergenic
985675483 5:1229471-1229493 AGGCCCCAGCCCAGGCTCAATGG + Intronic
986697728 5:10373611-10373633 ATACCCCAGGCCATAGTCAATGG + Intronic
987094267 5:14534124-14534146 AGACCCGAGGCCGAGCGCAGTGG - Intergenic
992212815 5:74497155-74497177 AGACCCAAGGCCAGGCTCAGTGG + Intergenic
997248284 5:132369935-132369957 CGACCCCAGGCCGCGCTCTGTGG + Exonic
1001362099 5:171097394-171097416 AGACCCAAAGCTGTGCTCCAAGG - Intronic
1002520875 5:179792807-179792829 AGGCCACAGGCCGTGCTGCAGGG - Intronic
1003345341 6:5261162-5261184 AGACCCCAGACGGTTCCCAAAGG - Exonic
1003795881 6:9602641-9602663 TGTGCCAAGGCCGTGCTCAATGG + Intronic
1005331221 6:24752356-24752378 TTACCCCAGGCCGTGCTCGGTGG - Intergenic
1007113123 6:39325014-39325036 AGAACTCAGGCCGGGCTCAGTGG - Intergenic
1011441373 6:87390939-87390961 AGACCCCAGGCTGGGCACAGTGG - Intronic
1012533362 6:100265523-100265545 AGTCCCCAGGCCGAGCTCATGGG + Intergenic
1015819618 6:137246369-137246391 AGTCCCCAGGCCGTGGACCAGGG - Intergenic
1017072027 6:150583956-150583978 ACACCCCTGGCCGTGCGCAGTGG - Intergenic
1017072998 6:150592994-150593016 AGACCCCATGCTGTACTGAACGG - Intergenic
1019707945 7:2505285-2505307 AGACCCCCGGCAGGGCTCATGGG + Intergenic
1021407473 7:20289087-20289109 AGACACCAGGGCCTGCTTAAGGG + Intergenic
1022199558 7:28103355-28103377 AAACCCCTGGCCGGCCTCAAGGG - Intronic
1022325287 7:29325345-29325367 AGACCCCAAGGCGTGATGAATGG - Intronic
1022725612 7:32978979-32979001 AAACCCCAGGCCGGGCGCAGTGG + Intronic
1025048002 7:55708717-55708739 AAACCCCAGGCCGGGCGCAGTGG - Intergenic
1025109703 7:56203771-56203793 AGACCCCAGGCTGGGTTCAGTGG - Intergenic
1026420580 7:70232665-70232687 AGACCCCAGGCTGGGCGCAGTGG - Intronic
1027230816 7:76271179-76271201 AGACCCCAGGCAGGGCGCAGTGG + Intronic
1027238877 7:76314410-76314432 AAACCCCAGGGCGTCCTCTAGGG - Intergenic
1029375499 7:100174715-100174737 AGTCTCCAGGCCCTGCACAAAGG + Exonic
1032714127 7:134489791-134489813 TGACCCAAGGCCAGGCTCAATGG + Intergenic
1034293239 7:149948679-149948701 ACTCCCCAGGCCTTGCTCAGTGG + Intergenic
1034812828 7:154148176-154148198 ACTCCCCAGGCCTTGCTCAGTGG - Intronic
1035398428 7:158549959-158549981 AGACCCCAGGACGAGGGCAAGGG - Intronic
1047391614 8:124456548-124456570 AGACCCCAGGCCGGGCGCAGTGG - Intronic
1047999880 8:130370011-130370033 AGACCCCAGGCCGGGCACAGTGG + Intronic
1048995308 8:139790439-139790461 AGACCACAGCCGGTGCTCACAGG + Intronic
1053368668 9:37542306-37542328 TGACTCCAGGCCGGGCGCAATGG + Intronic
1054856683 9:69907930-69907952 AGGCACCAGGCAGTGTTCAAAGG - Intergenic
1054908736 9:70434107-70434129 AGAACCCAGGCCGGGCACAGTGG - Intergenic
1055117173 9:72617447-72617469 AGACCACAGGCCAGGCACAATGG - Intronic
1058755766 9:108081815-108081837 AGACCCCAGACTCTGCCCAAGGG - Intergenic
1061490920 9:130943880-130943902 AGACGAGAGGCCGTGATCAAAGG + Intergenic
1062391404 9:136335379-136335401 AGCCCCCAGGCCGTGCCTCACGG + Intronic
1062627110 9:137448333-137448355 AGACCCCTGGCTCTGCACAAGGG + Exonic
1062720180 9:138037369-138037391 AGAATCCAGGCCGGGCTCAGTGG + Intronic
1189444544 X:41068255-41068277 AGACACCAGGCCCTGCTTGAAGG - Intergenic
1195516974 X:105787994-105788016 AGGCCCCAGACCATGCTCACTGG - Intergenic
1197810488 X:130437537-130437559 AGACACCAGGGCCTACTCAAGGG - Intergenic
1198100468 X:133417497-133417519 GAACCCCAAGCCGTGCTCAGAGG + Intergenic
1198974259 X:142318121-142318143 AGACACCAGGCCGGGCGCAGTGG + Intergenic