ID: 1185223640

View in Genome Browser
Species Human (GRCh38)
Location 22:49641217-49641239
Sequence TCCCTGGGGTGTCTGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185223640_1185223649 16 Left 1185223640 22:49641217-49641239 CCTGCCCACAGACACCCCAGGGA 0: 1
1: 0
2: 1
3: 33
4: 354
Right 1185223649 22:49641256-49641278 ATGTCTGCTCCGGTGTCCCCAGG No data
1185223640_1185223648 6 Left 1185223640 22:49641217-49641239 CCTGCCCACAGACACCCCAGGGA 0: 1
1: 0
2: 1
3: 33
4: 354
Right 1185223648 22:49641246-49641268 CACTGTCATCATGTCTGCTCCGG 0: 1
1: 0
2: 3
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185223640 Original CRISPR TCCCTGGGGTGTCTGTGGGC AGG (reversed) Intronic
900208450 1:1441421-1441443 TGCAGGGGGTGTCTGTGGGGGGG + Exonic
900685292 1:3944385-3944407 ACCCTGGGGTGTCTGGCGTCTGG - Intergenic
901491288 1:9597632-9597654 TCCCTGGGCTGGCCGAGGGCAGG - Intronic
901733483 1:11297274-11297296 TCCCTGGGGTCTCTTTGATCAGG - Intergenic
902186103 1:14726531-14726553 TTCCTCGAGTGTCTGTGGGCTGG + Intronic
902715745 1:18271617-18271639 TCCCTGGGGTGCCTAGGGGAGGG - Intronic
902728966 1:18356280-18356302 TCTCTGGGGTGTGTGTGGTGGGG - Intronic
902977197 1:20097635-20097657 TCCCTGAGGTCTCCCTGGGCTGG + Intergenic
903009266 1:20318742-20318764 CCCCTGGGCTGCCTGTGGGAGGG + Intronic
903229541 1:21913498-21913520 TCCGTGGGCTGTCTGAGGGCAGG - Intronic
903750291 1:25617080-25617102 TCCCTGCGCTGTCTGGGGCCCGG + Intergenic
903761863 1:25704012-25704034 TGGCAGGGGCGTCTGTGGGCAGG - Intronic
905175213 1:36131022-36131044 TCCCTGGGCTGTCTAAGGGAAGG - Intergenic
905863159 1:41363385-41363407 GCCCTGTGGTGCCTGTGAGCTGG + Intronic
906580323 1:46930434-46930456 TCCATGGGCTGTATGTGTGCAGG - Intronic
906838258 1:49107881-49107903 TCCCAGAGGTTTCTGTGGGTTGG - Intronic
907459526 1:54597176-54597198 TCCCAGGGCTGCCTGTGGGGAGG + Intronic
908153847 1:61332369-61332391 TCCTTGGGGTTTATGTGGGAGGG - Intronic
911565189 1:99455895-99455917 TCCCTGGGGTGTGTGTTTGTGGG - Intergenic
913535090 1:119764353-119764375 TCCCATGGGACTCTGTGGGCAGG - Exonic
916826288 1:168445065-168445087 TTCCTGGGGTGGCTGTTGGTGGG + Intergenic
919355487 1:196516569-196516591 TGCCTGAGGGGCCTGTGGGCTGG + Intronic
920103198 1:203531241-203531263 TCCCTGGGCTAGCTCTGGGCGGG - Intergenic
921440683 1:215182426-215182448 TCCCTGGGGTTTCAGTGGAAAGG + Intronic
923459714 1:234197636-234197658 ACCCTGGGGTTCTTGTGGGCAGG - Intronic
924612116 1:245582116-245582138 TCCCTGGTGTGTCTGACGGATGG - Intronic
1062810492 10:459803-459825 TCCCTGATGTGGCTGTGGGAAGG - Intronic
1062810515 10:459958-459980 TCCCTGATGTGACTGTGGGAAGG - Intronic
1063039061 10:2318115-2318137 GCCCAGGGGTGTCTGTGAGGAGG + Intergenic
1063690835 10:8285419-8285441 TCCCGGGGGTGGTGGTGGGCTGG + Intergenic
1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG + Intronic
1065553977 10:26895588-26895610 TCCTTGGGCTGTCTTTGGGGTGG + Intergenic
1065599341 10:27353026-27353048 TCCTTGGGCTGTCTTTGGGGTGG - Intergenic
1067125183 10:43509801-43509823 TCCCGGGCGTGTCTGTGAGGGGG - Intergenic
1067714037 10:48672708-48672730 TCTCTGGGCTGTCTGTGGAATGG - Intergenic
1069862686 10:71481358-71481380 TCCCAAGGGTGGCTGTGAGCTGG - Intronic
1070965955 10:80530508-80530530 TCCCTGGGAGGTCTCTGGGCTGG + Exonic
1071567896 10:86681012-86681034 TTCCTGGGCTGGTTGTGGGCAGG - Intronic
1072608674 10:97002780-97002802 GCCCTGGGGTGGCATTGGGCTGG + Exonic
1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG + Intronic
1073444782 10:103574184-103574206 AGCCTGGGTTATCTGTGGGCAGG - Intronic
1074381395 10:112983595-112983617 TCCCTTGGGCCTCTGTGGTCAGG + Intronic
1075472978 10:122707155-122707177 TCCCTGGGGAGCTGGTGGGCTGG + Intergenic
1076238380 10:128883449-128883471 TGCCTGGTGTGCCTGTGAGCAGG - Intergenic
1076320905 10:129580708-129580730 ATCATGGGGTGTCTGTGGTCGGG - Intronic
1076409043 10:130232874-130232896 TCTCAGGGCTGGCTGTGGGCAGG + Intergenic
1076589301 10:131572175-131572197 TCCCTTGGGTGCTTCTGGGCTGG - Intergenic
1076866247 10:133167790-133167812 TCCCTCTGGTGTCTGAGGGTAGG - Intronic
1077359741 11:2135518-2135540 TCCCATTGGTGTCTGGGGGCGGG + Exonic
1078175193 11:8964692-8964714 TTGCTGGGGTCTCCGTGGGCGGG - Exonic
1080269593 11:30436998-30437020 TGCCTGGGCTGGCTGTGGGAGGG + Intronic
1080675534 11:34423400-34423422 TCGCTGGGGTGACAGTGGGGTGG + Intergenic
1081625794 11:44654362-44654384 CCCCTGGGCTGTCTGTGGCACGG + Intergenic
1083756825 11:64796413-64796435 GGCCTGGGGTGTTGGTGGGCAGG + Intronic
1083988438 11:66232113-66232135 TCCCTGGGGAGCCTGAGGACAGG - Intronic
1084458283 11:69281637-69281659 TCCCTGGTGTGTTTCTGAGCTGG + Intergenic
1084701039 11:70786226-70786248 ACCCTGGGCTGTCTCTGGCCTGG + Intronic
1084708857 11:70831522-70831544 TCTGTGGGATGCCTGTGGGCAGG - Intronic
1087320101 11:96647487-96647509 TACCTGGGGTGTATCTGAGCAGG + Intergenic
1088578893 11:111298238-111298260 TCTGTGGGGTGCCTGTGTGCAGG + Intergenic
1088718762 11:112573553-112573575 CTCCTGGGGTTTCTGTGGGAAGG - Intergenic
1088794991 11:113260304-113260326 TACCTGGGATGGCTGTGGGCTGG - Exonic
1089129350 11:116199756-116199778 TGCCTGGGGTATCTGAGGGGAGG + Intergenic
1089392962 11:118114563-118114585 TCCCTGGGGTGATTTAGGGCAGG + Intronic
1089781299 11:120874992-120875014 TGCCTTGGCTGTGTGTGGGCAGG + Intronic
1090204681 11:124877762-124877784 TCCCTGGGGAGGATGTGAGCTGG + Intronic
1090833466 11:130436698-130436720 TCCCGGGGCTGTCTGGAGGCAGG + Intergenic
1091461582 12:647156-647178 TCCCTCAGGTGTCTGTGCCCAGG + Intronic
1094351422 12:29530179-29530201 TCCCTGGGGTCTCCTTGGCCAGG - Intronic
1094490918 12:30960108-30960130 ACCCTGTGGTGTCTGTGGGTGGG + Intronic
1096524593 12:52202892-52202914 CCCCTGTGGTGTGTGTGGGTGGG + Intergenic
1097337168 12:58395873-58395895 CCCCTGAGCTGGCTGTGGGCAGG - Intergenic
1098914078 12:76239552-76239574 TCCCTGGGGTGTCTTTTGTCAGG + Intergenic
1099126028 12:78759389-78759411 TCCAAGGGGAGTCAGTGGGCAGG + Intergenic
1100333020 12:93603256-93603278 TACCTGGGGTCACTGTGTGCAGG + Intergenic
1101858625 12:108464568-108464590 TTCCTTGGGTGTCTGGGGCCCGG - Intergenic
1102041048 12:109800877-109800899 GCCCTTGGGTGTCGCTGGGCAGG - Intronic
1102909243 12:116699901-116699923 GTCCTGGGGTGTCTGAAGGCAGG + Intergenic
1103348372 12:120265810-120265832 TCGCGGGGGTGTCCGGGGGCGGG - Intergenic
1103742868 12:123103147-123103169 TCCCTGGGGCATCTGGTGGCAGG + Intronic
1103877666 12:124141159-124141181 TCCTTTGGATGTCTGTGGCCAGG + Intronic
1103928047 12:124434496-124434518 TCCTTGGGGGGTCTGTGGAGGGG - Intronic
1103937043 12:124482375-124482397 TCCCTGGGGTGGGCTTGGGCTGG - Intronic
1105296039 13:19088706-19088728 GCCCTGGTGTGTGTGAGGGCTGG - Intergenic
1108178927 13:47821977-47821999 TCCCCGGGGTGCATGTGGGGAGG - Intergenic
1108178999 13:47822457-47822479 TCCCTGGGGTCCATGTGGGGAGG + Intergenic
1108510311 13:51149620-51149642 TCTCTTGTGTGTCTGGGGGCTGG - Intergenic
1112329650 13:98467512-98467534 TCCCTGGGGAGACTGGGGACAGG - Intronic
1112435230 13:99387129-99387151 TCACTGAGGTTCCTGTGGGCAGG - Intergenic
1112954898 13:105044523-105044545 CCCCTGGGGTATCTTGGGGCTGG + Intergenic
1113423994 13:110192837-110192859 TCCCGGGGGTCCCTGTGGCCCGG + Exonic
1113483165 13:110636293-110636315 ACACTGAGGCGTCTGTGGGCGGG + Intronic
1113759017 13:112834781-112834803 TTCCTGGGGTGTCACTGGGAAGG - Intronic
1119656335 14:76419881-76419903 GCTCTGGGGTGGATGTGGGCAGG + Intronic
1120637959 14:86974574-86974596 TCCTAGGGGTGTGTTTGGGCTGG + Intergenic
1120822214 14:88922478-88922500 TCCCTGAGGGGTCTGTGCCCTGG + Intergenic
1121838727 14:97115268-97115290 TTCCTGGGCTGCCTGTGGGGTGG + Intergenic
1122317952 14:100836663-100836685 TCCCTGGGCCGGGTGTGGGCAGG - Intergenic
1122374474 14:101248914-101248936 GCCCTGGGGTGGCTGTAAGCGGG + Intergenic
1122797306 14:104212490-104212512 ACCCTGGGGTACCTGAGGGCAGG + Intergenic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1202862107 14_GL000225v1_random:89587-89609 TCCCAGGGGAGTCTGTGGCAGGG - Intergenic
1123939684 15:25210824-25210846 TGCCTGGTGAGGCTGTGGGCCGG + Intergenic
1124468322 15:29960710-29960732 TTCCTGTGGAGTCTGTGGGCAGG - Intronic
1127905831 15:63375075-63375097 TGCCTGGGCTTTCTGTGGGACGG - Intronic
1128065314 15:64760886-64760908 TTGGTGGGTTGTCTGTGGGCAGG - Intronic
1128223925 15:65988753-65988775 GCCCTGGAGTCTCTCTGGGCTGG + Intronic
1128261874 15:66238264-66238286 TCTCTGGGGCATCTGTGGACTGG - Intronic
1128706954 15:69843451-69843473 TCCCTGAGGTGGCTGGGAGCTGG + Intergenic
1128767355 15:70259282-70259304 TCCCAGGGGCAGCTGTGGGCGGG + Intergenic
1129702193 15:77774426-77774448 TGCTTGTGGTGTCTGGGGGCTGG - Intronic
1129979029 15:79849386-79849408 CCCCAGGGGTGTGTGTGGGGTGG - Intronic
1132674265 16:1115156-1115178 TCCCTGGTGTGTGGGTGGCCGGG + Intergenic
1132956529 16:2597286-2597308 TCCCAGGGATTTCTGTGTGCAGG + Intronic
1133413664 16:5589201-5589223 TCCCTGGTGGGTTTGTGGGGCGG + Intergenic
1133916427 16:10113233-10113255 TTCCTGGGGGGGCTGGGGGCAGG - Intronic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1135157651 16:20067205-20067227 TGCCTGGGCTGGCTTTGGGCTGG - Intronic
1135933343 16:26758085-26758107 GCCTTGGGGTGCCTGTGGACAGG - Intergenic
1137057385 16:35752159-35752181 TGCCTGGGGAGACTGGGGGCTGG + Intergenic
1137613799 16:49835506-49835528 TCTCTGAGGGGTCTGTGGCCTGG - Intronic
1137724931 16:50650728-50650750 ACCCTGGGGTGTCTGGCTGCAGG + Intergenic
1138483369 16:57318741-57318763 TCCCTGGGGTGGGTGGGGGATGG + Intergenic
1140740076 16:77933725-77933747 GCCCTGAGGTGACAGTGGGCTGG + Intronic
1140841949 16:78848074-78848096 TCTCTGGTGTGTCTGGGGTCAGG - Intronic
1141140363 16:81493173-81493195 CCCCTGAAGTGTCTGTGTGCCGG - Intronic
1141333217 16:83131199-83131221 TCCTGTGTGTGTCTGTGGGCGGG - Intronic
1141771765 16:86093962-86093984 TCCTTTGGGTGCCTGTGGCCTGG + Intergenic
1141867741 16:86762317-86762339 GCCCTGCGGTGTGTGTGGGGAGG + Intergenic
1142065480 16:88059935-88059957 CTCCTGGGGTGTGTGTGTGCAGG - Intronic
1142872006 17:2827196-2827218 TCCCAGGGGTGTGTGTGGTTGGG + Intronic
1143376417 17:6470215-6470237 CCCTTGGGGTGGCTGTGGGCAGG + Intronic
1143393298 17:6573126-6573148 AGCCTGGGCTGTCTCTGGGCCGG - Intergenic
1143626042 17:8110592-8110614 TCTCTGGGGTGGAAGTGGGCAGG - Intronic
1144063259 17:11601860-11601882 TGCCTTGTGTGTGTGTGGGCGGG + Intronic
1144576529 17:16433196-16433218 TCACTGGTGTGCCTCTGGGCAGG + Intronic
1144628469 17:16857592-16857614 TGTCTGGGGTGAGTGTGGGCAGG + Intergenic
1144654825 17:17028791-17028813 TGTCTGGGGTGAGTGTGGGCAGG - Intergenic
1145160057 17:20568163-20568185 TGTCTGGGGTGAGTGTGGGCAGG + Intergenic
1145298567 17:21613642-21613664 TCCCTGAAGTGTGTGTGGGGGGG + Intergenic
1145351674 17:22089710-22089732 TCCCTGAGGTGTGTGGGGGGGGG - Intergenic
1145795952 17:27655445-27655467 GGCCTGGGGTGTCTGAGGACTGG - Intergenic
1145810402 17:27760770-27760792 GGCCTGGGGTGTCTGAGGACTGG - Intronic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1146574094 17:33976828-33976850 TCCTGGGGGTGGGTGTGGGCAGG + Intronic
1146888343 17:36487120-36487142 TCCCTGGTGTCTCTGTGTGTCGG + Intronic
1146976923 17:37121331-37121353 TGACTGGGCTGCCTGTGGGCTGG - Intronic
1147018388 17:37510844-37510866 TCCCCTGGGTGTGTGTGGGCAGG + Intronic
1148134481 17:45283486-45283508 TCCCTGGTGTGTACTTGGGCTGG - Intronic
1148470776 17:47891962-47891984 TCCCTGGTGTGTCTGGAGGCAGG - Intergenic
1148683463 17:49487514-49487536 TCCCTGGGGAGTCTGAGTCCCGG - Intergenic
1148695565 17:49556228-49556250 AGCCTGGTGTGTCTCTGGGCAGG - Intergenic
1149549155 17:57527268-57527290 TGCCTGGGGTGTGGGTGGGTGGG - Intronic
1149664249 17:58354666-58354688 TGCCTGTGGCGTGTGTGGGCTGG - Exonic
1149774699 17:59348197-59348219 TCCATGGGGTGTCTGAGAGGAGG - Intronic
1150657866 17:67052209-67052231 TACCTGGGGTGTCTGACTGCTGG - Intronic
1151206364 17:72510792-72510814 TCCCTAGGGCCTCTGTGGTCTGG + Intergenic
1151552467 17:74830051-74830073 TCTCTTCGGTCTCTGTGGGCAGG - Intronic
1151815493 17:76469556-76469578 TCCCCTGGGTGCCTGTGGTCAGG - Intronic
1152241345 17:79162998-79163020 GCCCTGGCGTGTCTGTGCTCAGG - Intronic
1152593938 17:81229208-81229230 TCGCTGGGGTCTCCGGGGGCTGG + Exonic
1152618436 17:81348579-81348601 TGGCTGGGGTGTCTGTGGGAGGG + Intergenic
1154106458 18:11527711-11527733 TCACTGTGGTGCCTTTGGGCAGG + Intergenic
1155098799 18:22587908-22587930 ACACTGGGGTCTGTGTGGGCAGG + Intergenic
1156463683 18:37335646-37335668 TCCCTGGCCTGTGTCTGGGCAGG + Intronic
1157477997 18:48035634-48035656 GACCTGGGATGTCCGTGGGCAGG + Intronic
1161208676 19:3055474-3055496 CCCCTGGAGTGTCTCTGGCCCGG + Intronic
1161212428 19:3074339-3074361 CCCCTTGGGTGTCTATGGGGAGG - Intergenic
1161578357 19:5067145-5067167 GCCCTGGGGTATGTCTGGGCGGG - Intronic
1161591052 19:5129215-5129237 TCCTGGGGGAGGCTGTGGGCTGG + Intronic
1161594155 19:5142650-5142672 TCCCTGGGGAGCCTGGGGGTGGG - Intronic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1162148959 19:8631469-8631491 TCTCTGGGGGGTCTGGAGGCAGG + Intergenic
1162359208 19:10207461-10207483 ATCCTGTGGTTTCTGTGGGCTGG - Intronic
1162544959 19:11323699-11323721 TCCCTGGGGTATGTGTGAGGGGG - Exonic
1163592927 19:18204440-18204462 TACCTGGGGTGGGTGCGGGCGGG - Intergenic
1163692527 19:18745373-18745395 CCCCTGGGCTGTCTCTTGGCAGG + Intronic
1163791082 19:19306426-19306448 TCCCTTGGAGGTCTGTGGCCAGG + Intronic
1164786147 19:30932667-30932689 TCCCTGGGTTGGCTTTGGGTAGG + Intergenic
1164821655 19:31255656-31255678 ACCCCGGGGTTTCTGGGGGCAGG + Intergenic
1165725512 19:38110099-38110121 TCCTTGGGCTGTGTGTGAGCAGG + Intronic
1165858935 19:38896844-38896866 TCTCAGGGGTGTGGGTGGGCTGG + Intronic
1165939377 19:39407609-39407631 ACCCAGGGGTTTCTGCGGGCGGG + Intronic
1166253024 19:41584539-41584561 TCCCTGGGGAGTCGGGAGGCTGG - Intronic
1166999762 19:46738972-46738994 ACTGTGGGGTGACTGTGGGCTGG - Intronic
1167327246 19:48834345-48834367 TCCCTGCAGAGTCTGGGGGCCGG - Exonic
1168632898 19:57971343-57971365 GCCCTGGGGTGGTTGGGGGCAGG - Intronic
925087021 2:1116492-1116514 GCCCTGGTGTGTGTGTGGTCTGG + Intronic
925157925 2:1661479-1661501 TGCCTGGGGTGTGTGTGGCGAGG + Intronic
927533851 2:23836877-23836899 TCCATGGGGTGGCCATGGGCAGG + Intronic
928127877 2:28628670-28628692 TCCCTGGGATGCATGTAGGCAGG + Intronic
929600433 2:43201113-43201135 ACCCTGGGTTTTCTGAGGGCGGG + Intergenic
930533572 2:52619929-52619951 TCCTGGAGGTGTCTGAGGGCAGG - Intergenic
932239589 2:70146289-70146311 TCCCAGAGGTGTCTGGAGGCTGG + Intergenic
934554891 2:95281921-95281943 TCCCTGGGGTGTCTGCAAACTGG - Exonic
934937572 2:98476553-98476575 GCCCTGGGGTGTGTGTGGGGAGG + Intronic
935591185 2:104846503-104846525 GCACTGGGGTGTCTCAGGGCCGG + Intergenic
935697998 2:105786647-105786669 TCCCTGTGGTGGCTGTGGCCTGG + Intronic
937987596 2:127645451-127645473 TCCCTGGGGTGGCTCCGGGCTGG - Intronic
938053865 2:128198866-128198888 GCCCTGGGGTGTCAGAGTGCTGG - Intergenic
940279998 2:151978959-151978981 TCAGTGGGGTGGCTGAGGGCGGG - Intronic
942045159 2:172095652-172095674 TCACTGGTGTGTGTGGGGGCGGG + Intergenic
943714291 2:191133448-191133470 TTCCTGGTGTGTGTGTGGGTGGG + Intronic
946312427 2:218890198-218890220 GGCCTGGGCTGGCTGTGGGCAGG - Exonic
946394582 2:219436681-219436703 TTCCTGGAGTCTCTGTGGCCAGG + Intronic
948279392 2:236734913-236734935 TCCCATGGATGTCTGTGGGTTGG + Intergenic
948699332 2:239750516-239750538 TCCCTGGGATCTCCCTGGGCAGG + Intergenic
948793608 2:240391439-240391461 ACCCTGGGGGGTCTGTGTCCAGG - Intergenic
948890495 2:240904956-240904978 TCCCTGGGGTGCCAGGGGCCTGG - Intergenic
1169141936 20:3231328-3231350 ACCTCTGGGTGTCTGTGGGCAGG + Exonic
1169488084 20:6050341-6050363 TCCCTTGGAAGTCTATGGGCAGG - Intronic
1170284857 20:14695702-14695724 TCACTGATGTGGCTGTGGGCTGG - Intronic
1170666759 20:18393281-18393303 TCCCTGGAGGGAGTGTGGGCAGG - Intronic
1171245818 20:23608719-23608741 TCCCAGGGGTTTCCGTGTGCTGG + Intergenic
1172848763 20:37945381-37945403 TGCCTGGGGGGTGTGTGGGGTGG + Intergenic
1173139211 20:40467494-40467516 TCCCTTGGGTGTCTGTTATCAGG - Intergenic
1173503450 20:43569540-43569562 TCCCTGGGCTGGCTCTCGGCTGG + Intronic
1174182107 20:48681408-48681430 TCCCAGGGGTGGATGTGGCCAGG - Intronic
1175444921 20:59013370-59013392 TCCCTCTGGTGACTGTGGGAAGG + Intergenic
1175563625 20:59954726-59954748 TCCCAGGTGGGTGTGTGGGCAGG + Intergenic
1175682925 20:61004372-61004394 TGCCTGGGATGTATGTGGACTGG + Intergenic
1175720011 20:61280155-61280177 ACCCTGGGCTGTGTGTGGGATGG + Intronic
1175888111 20:62303479-62303501 CCCCTGGGGTGTTTGCGAGCAGG - Intronic
1175917290 20:62432480-62432502 TCCGTTGGGGATCTGTGGGCCGG - Intergenic
1176028810 20:63000336-63000358 TCCCTGGTGTGTCTTTGCCCAGG - Intergenic
1176041703 20:63069078-63069100 TCCTTGTGCTGTCTGTGGGATGG - Intergenic
1176388757 21:6152658-6152680 TCCCTGGTGTGTGTGTTTGCGGG - Intergenic
1177355943 21:20007690-20007712 TTCCTGGGGTGTGTGTTGGGAGG - Intergenic
1178470224 21:32885921-32885943 TCTCAGGGGTGTCTGGGGGTGGG - Intergenic
1179734715 21:43385590-43385612 TCCCTGGTGTGTGTGTTTGCGGG + Intergenic
1179841690 21:44080108-44080130 TACCTGGGCTGTCTGACGGCTGG - Exonic
1179937573 21:44614943-44614965 TGCCTGGGGTTCCTGTCGGCAGG - Intronic
1179959967 21:44762645-44762667 GCCCTGGGGTCTTTGTAGGCAGG + Intergenic
1180781591 22:18523206-18523228 TCCCAGGGCTGGCTGGGGGCTGG + Intergenic
1181238475 22:21462549-21462571 TCCCAGGGCTGGCTGGGGGCTGG + Intergenic
1181573001 22:23777976-23777998 TCCCTGGGGTGTATGGAGCCTGG + Intronic
1182050629 22:27310268-27310290 GCCATGGGGTGACGGTGGGCAGG + Intergenic
1182323133 22:29491312-29491334 TCCCTGGGAAGGCTGGGGGCAGG + Exonic
1182508645 22:30803170-30803192 TCCCTGGGGTGAGTCAGGGCGGG + Intronic
1182854564 22:33505687-33505709 TCACTGGGGAGTCTGTGCACAGG + Intronic
1183198220 22:36368022-36368044 CCTCTGGGGTGTCTGTATGCAGG - Intronic
1183237317 22:36629320-36629342 TCCCTGGGCAGGCTGTGAGCTGG + Intronic
1183493217 22:38127699-38127721 TCTCTGGACTTTCTGTGGGCTGG - Intronic
1185053784 22:48567522-48567544 TCCCTGCGGTTGCTGTGGGCGGG + Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
949836590 3:8276733-8276755 TCCCTGGGGTTTCCATGGCCTGG + Intergenic
950518114 3:13480382-13480404 TCCCAGGGGTCCCGGTGGGCGGG + Intronic
953139170 3:40211487-40211509 TCCCTGGCTTGTCTGTGAGTTGG + Intronic
953876744 3:46670994-46671016 TCCCTGGAGTGCCAGTGGCCAGG + Exonic
953957285 3:47241091-47241113 TCCCTGGGACTTCTGTGGCCAGG + Intronic
954748536 3:52800760-52800782 TCCCTGGGTTCCCTGTGGTCTGG + Intronic
956649597 3:71492004-71492026 TCCCTGGGGTTGGTCTGGGCTGG - Intronic
960458880 3:117908504-117908526 CCACTGGGGTGTCTTTGAGCAGG - Intergenic
961450370 3:126999779-126999801 TCCCTGGCCTATCTGTGGGGAGG + Intronic
961830083 3:129618885-129618907 TGCATGGGGTGTTTATGGGCTGG - Intergenic
962939774 3:140115384-140115406 TGCTTGGAGTGTCTGTGGGTGGG + Intronic
962966398 3:140358273-140358295 TCCCAGAGGTGGCTCTGGGCTGG + Intronic
963228836 3:142889306-142889328 TCCCCGGGGTCCCTGAGGGCTGG - Intergenic
966883075 3:184360770-184360792 ACCCTGGGGTGGGTGGGGGCTGG + Intronic
967878201 3:194281004-194281026 TCCCTGGGGTGCCTGTGTGGAGG + Intergenic
968507889 4:980173-980195 GCCCTGGGGTGACTGAGGGCAGG + Intronic
968521094 4:1035182-1035204 TCCCTGGGGTGCCCATGTGCAGG - Intergenic
969304326 4:6317231-6317253 TCCCCGGGGTGTGGGTGGGTTGG + Intergenic
969570658 4:8006349-8006371 TCCCTGAAGAGTCTGTGGGGAGG + Intronic
974080542 4:57207929-57207951 TCTCTGGGTTTTCTGTGGGTGGG - Intergenic
974607706 4:64174097-64174119 TCCCGGTGGAGTCTGTGGCCTGG + Intergenic
975322478 4:73024138-73024160 ACCCTTGGGTGGGTGTGGGCAGG + Intergenic
977943500 4:102883268-102883290 TCCCTGGGGTGACTTAGGGCAGG - Intronic
981419179 4:144529531-144529553 TCCCTGGGGATTCTGCGGGAAGG - Intergenic
981724355 4:147832099-147832121 TCCCTTGTGTGTGTGTGGGTGGG - Intronic
985591516 5:767846-767868 TCCCTGCGGTGTGTGTTGGTTGG - Intergenic
985609432 5:878805-878827 TCCCTGCGGTGTGTGTTGGTTGG - Intronic
985619630 5:947411-947433 TCCCTAGGCTGTCTGAGGTCCGG + Intergenic
985665797 5:1181011-1181033 TCCCTAGGGCTTCTGTGGGGAGG - Intergenic
985759473 5:1737704-1737726 TCTCTGGGCTGTCTGAGGACAGG - Intergenic
985792065 5:1934256-1934278 TCCCTGCCTTGTGTGTGGGCTGG + Intergenic
986481875 5:8197820-8197842 TCCCTGTAGTGTCCGTGAGCTGG + Intergenic
987086768 5:14477227-14477249 TATCTGGGGTGTCTGTGAACAGG + Intronic
987238418 5:15967949-15967971 TACGTGGGGAGTTTGTGGGCAGG - Intergenic
989780800 5:45262524-45262546 TGGCTGGGGGGTCTGTGTGCTGG + Exonic
992023595 5:72649518-72649540 GCCCTCGGGTGTGTGGGGGCAGG - Intergenic
993357526 5:86932936-86932958 TACCTGAGTTTTCTGTGGGCAGG - Intergenic
995206419 5:109486336-109486358 TCACTGGTGTGGCTGTTGGCTGG - Intergenic
995453811 5:112331479-112331501 TCCCTGGGGTATCAGAGGGCTGG + Intronic
997303684 5:132823948-132823970 GCCCAGGGGTGGCTCTGGGCTGG + Exonic
998093245 5:139382966-139382988 TCCTTGGGGTGTCACTGGCCGGG + Intronic
999325831 5:150642748-150642770 TCCATGGAGTCACTGTGGGCTGG + Intronic
1002176443 5:177403825-177403847 CCCCTGGGGCGGCTCTGGGCGGG + Intronic
1002456042 5:179345739-179345761 CCCCTGGGGTGGCTGGCGGCGGG - Intergenic
1002473256 5:179450123-179450145 TCACTGGGGTCTCTGTGGGAAGG + Intergenic
1002480966 5:179500530-179500552 TCACTGGGGTCTCTGTGGGAAGG - Intergenic
1004170142 6:13289257-13289279 ACCCTGGGCTGTCTGCTGGCTGG - Exonic
1004346995 6:14857703-14857725 TCACGGGGGTGTGTGTGGGGGGG + Intergenic
1005648082 6:27861097-27861119 GCCCTGAGGTGTTTGTGGGAAGG - Intronic
1006300750 6:33192539-33192561 TCCCTTCGGTGGCTGTGGGCGGG - Intergenic
1007384556 6:41511936-41511958 TACCAGGGCTGTCTGTGGCCTGG - Intergenic
1007549986 6:42721890-42721912 TGCCAGGGGTGTCTGTGTCCCGG + Exonic
1007764152 6:44151117-44151139 CTCTGGGGGTGTCTGTGGGCGGG + Intronic
1007776604 6:44227510-44227532 TGGCTGGGGTGTCTGCGGGAAGG + Intronic
1011392290 6:86867501-86867523 TTCCTAGGGTGCCTTTGGGCTGG + Intergenic
1013040718 6:106430737-106430759 TCCATGGGGCGTCTGTAGCCGGG + Intergenic
1013748000 6:113368412-113368434 TCACTGGGATGTGTGTGGGGAGG - Intergenic
1013861206 6:114637699-114637721 TCTCTGTGGTGTCTCTCGGCAGG - Intergenic
1016328206 6:142926943-142926965 TCCCTCGGGTGTCAGCGGACGGG + Intronic
1017504159 6:155052111-155052133 TACCTGTGGTCTCTGTGGGAAGG + Intronic
1018705309 6:166460035-166460057 ACCCTGGGGTGGCTCTGGGTCGG - Intronic
1019014108 6:168867387-168867409 GTCCTGTGGTGTCTGAGGGCAGG - Intergenic
1019523402 7:1470401-1470423 GCCCTGGGGTGGCTCCGGGCCGG - Exonic
1019772716 7:2893783-2893805 GTCCTAGGGTGTCTGTTGGCTGG - Intergenic
1020002434 7:4763528-4763550 TCCCTGGGCTGTCCGTGAGCAGG + Exonic
1020402982 7:7798722-7798744 TCTCTGGGGACTCTGTGGTCTGG - Intronic
1022536875 7:31103753-31103775 TCACTGGGCTCTCTGTGGCCAGG - Intronic
1022621831 7:31992246-31992268 TCCCTTGGGTGTCACTGAGCTGG - Intronic
1022870273 7:34471327-34471349 TCCCAGTGGTGGCAGTGGGCAGG + Intergenic
1023905779 7:44520875-44520897 TCTCTGGGGTGGCTGTGGGCTGG - Intronic
1024237504 7:47409303-47409325 CCCCTGGGCTGTTTATGGGCTGG - Intronic
1024237522 7:47409364-47409386 CCCCTGGGCTGTTTATGGGCTGG - Intronic
1026291258 7:69008100-69008122 TCCCTGGGTTCTCTGGGGCCTGG + Intergenic
1026805047 7:73424159-73424181 TCCCTGGCCCCTCTGTGGGCCGG + Intergenic
1026848705 7:73711833-73711855 TGCCAGGGGTCTCTGAGGGCAGG - Intronic
1027049098 7:75010422-75010444 CTCCTGGGGTGTGTGTGTGCAGG + Intronic
1029476529 7:100788221-100788243 TCCCTGGGATGTTTGTGGCAGGG + Intronic
1031115425 7:117662663-117662685 TCCCTGGGGTGTTTGTATGGTGG + Intronic
1032160285 7:129504303-129504325 CCCCTTGGCTGCCTGTGGGCTGG + Intronic
1032645002 7:133813850-133813872 CCCCTGGGGTGTATGTGTGGTGG - Intronic
1033741272 7:144277416-144277438 TCAGTGGAGTATCTGTGGGCTGG + Intergenic
1033752631 7:144372198-144372220 TCAGTGGAGTATCTGTGGGCTGG - Intronic
1035074527 7:156169191-156169213 TTCCTGGGGGGACAGTGGGCGGG + Intergenic
1035312426 7:157977904-157977926 TTCCCGATGTGTCTGTGGGCCGG + Intronic
1035769805 8:2138156-2138178 TCCGTGGTGTGTCTGAGGGCAGG - Intronic
1037439760 8:18903656-18903678 TCCCTGGGGTATCAGTGCCCTGG - Intronic
1037484174 8:19331756-19331778 TACCTAGGGTTGCTGTGGGCAGG - Intronic
1039468740 8:37800995-37801017 TCCTTGGGGAGTCTGAGTGCTGG + Intronic
1040284695 8:46093801-46093823 TCCCTGGGGTGACTGCAGGTGGG + Intergenic
1040309018 8:46227069-46227091 CGCCAGGGGTGTCTGGGGGCAGG + Intergenic
1042527363 8:69777493-69777515 TCACTGGGGTGTGTGTGGGTGGG + Intronic
1043286545 8:78538846-78538868 TCCCTGGGTTGTGTGTAGGATGG - Intronic
1043643620 8:82488936-82488958 TGCATGTGGGGTCTGTGGGCAGG + Intergenic
1045058836 8:98393751-98393773 TGCCTGGGGTCTCTGTTGGGAGG - Intergenic
1045769168 8:105714190-105714212 TTCCTAGGGTGTGTGTGGGGAGG + Intronic
1047005924 8:120620655-120620677 TCCCTGGTGTGTGTGGGGGTGGG - Intronic
1047167379 8:122454211-122454233 TCCCTTGAGTCTCTGTGAGCAGG + Intergenic
1049023435 8:139972998-139973020 TCCATGGGGTAGCTGGGGGCAGG - Intronic
1049270401 8:141692669-141692691 TCCCTTCGGTGCCTGTGGGCCGG + Intergenic
1049418681 8:142507235-142507257 TCCCTGGGCTGTGTGTTGGGAGG + Intronic
1049591863 8:143466332-143466354 TCCCTGGGCTCTAGGTGGGCAGG + Intronic
1051911160 9:22154849-22154871 TCTGTGGGGTTGCTGTGGGCAGG - Intergenic
1052941113 9:34132809-34132831 TTCCTGGGGGGGCTGGGGGCAGG + Intergenic
1053136139 9:35651127-35651149 TCCCTGAGGACTCTGAGGGCGGG + Intergenic
1053317025 9:37060551-37060573 TGCATGGGGTCTCTGTGGCCTGG - Intergenic
1055516264 9:77036689-77036711 TCCTTGGGGTGTGTGTTGGGGGG - Intergenic
1055662617 9:78520197-78520219 ACTCTGGGGGGTCTGAGGGCGGG + Intergenic
1056753660 9:89368893-89368915 TCCATGGGGGGCCTGTGGGAAGG + Intronic
1056971481 9:91208555-91208577 GCCCTGCGGTGGCTGTGGTCAGG - Intergenic
1057297891 9:93860036-93860058 AGCCCGGGGTGTCTGGGGGCTGG - Intergenic
1057522563 9:95771842-95771864 TCCCCTGGCTGTCTGTCGGCAGG - Intergenic
1058592334 9:106578263-106578285 TCCCTGAGGTGACAGAGGGCAGG + Intergenic
1058874736 9:109234169-109234191 TGCTGGGGGTGTCTGTGAGCTGG + Intronic
1059353787 9:113684528-113684550 TGCATGTGGTGTCTGAGGGCAGG - Intergenic
1059706746 9:116830976-116830998 TCCATGGTGTGTCTGTGGGTGGG - Intronic
1060736662 9:126070535-126070557 TCCCTGGCCTGTCTGTCTGCTGG + Intergenic
1060804484 9:126565862-126565884 TCCCTGAGATGTCTGTGTGGCGG - Intergenic
1060927813 9:127467554-127467576 TGCCTGGGATGACTGTAGGCAGG - Intronic
1060971616 9:127741718-127741740 GCCCTGGGGTGCCTTTGGGATGG - Intronic
1060992571 9:127857311-127857333 TCCATGAGGTGTCTGGGGTCGGG - Intergenic
1061021010 9:128014758-128014780 CCCCTGGGGAGCCTGTGGGCTGG - Intergenic
1061307618 9:129741119-129741141 TGCCTGGGGTGGGGGTGGGCAGG + Intronic
1061488128 9:130930592-130930614 TCCCTGGGCTGTCACTGTGCAGG - Intronic
1061721902 9:132557119-132557141 ATCCTGGGGTGTGTGTGTGCAGG + Intronic
1061759175 9:132838101-132838123 TCCTTGTGGTGTCATTGGGCTGG - Intronic
1061871487 9:133523084-133523106 TCCCAGGGGTGACAGTGGCCTGG - Intronic
1061912932 9:133734562-133734584 TCCCTGTCTTTTCTGTGGGCTGG - Intronic
1062290444 9:135791999-135792021 ACCCTGGAGTGGATGTGGGCCGG - Intronic
1062331834 9:136048266-136048288 TCCCTGGGGTGGCTGTCAGCAGG + Intronic
1062395748 9:136351941-136351963 TCCCTGGGGCGTCAGTGGCCGGG + Intronic
1062537602 9:137027775-137027797 TCGCTGGGGCCGCTGTGGGCGGG - Exonic
1062545796 9:137063306-137063328 TCTGTGGGGTTGCTGTGGGCAGG + Exonic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1187567011 X:20460721-20460743 TTTCTGGGGTGTCGGTGGGGGGG + Intergenic
1189102177 X:38202069-38202091 ACCCTGTGGTGACAGTGGGCAGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191790883 X:64970609-64970631 TCCCTGTGGAGTCTGTGGTTGGG + Intronic
1192204198 X:69085482-69085504 TTCCTTGTGTGACTGTGGGCAGG + Intergenic
1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG + Intronic
1194885806 X:99314650-99314672 ACCCTGGGGTGTCTCTAAGCTGG - Intergenic
1194993724 X:100571358-100571380 TCCCAGGGGTGACTGTTGGAAGG + Intergenic
1199076834 X:143534925-143534947 TCCCAGGGGGATCTGTGGGAAGG - Intergenic
1201057553 Y:10011079-10011101 CCACTGTGGTGGCTGTGGGCTGG + Intergenic
1201175826 Y:11307826-11307848 TCCCAGGGGAGTCTGTGGTGGGG + Intergenic