ID: 1185224021

View in Genome Browser
Species Human (GRCh38)
Location 22:49643001-49643023
Sequence GTCTGGATCTGCAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185224021_1185224035 24 Left 1185224021 22:49643001-49643023 CCCTCCTGCCTGCAGATCCAGAC 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1185224035 22:49643048-49643070 CCTAGAGGCTCGAGCCACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1185224021_1185224036 25 Left 1185224021 22:49643001-49643023 CCCTCCTGCCTGCAGATCCAGAC 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1185224036 22:49643049-49643071 CTAGAGGCTCGAGCCACAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1185224021_1185224029 9 Left 1185224021 22:49643001-49643023 CCCTCCTGCCTGCAGATCCAGAC 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1185224029 22:49643033-49643055 AGGCGCCCCAAGCCTCCTAGAGG 0: 1
1: 0
2: 1
3: 2
4: 75
1185224021_1185224037 29 Left 1185224021 22:49643001-49643023 CCCTCCTGCCTGCAGATCCAGAC 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1185224037 22:49643053-49643075 AGGCTCGAGCCACAAAGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185224021 Original CRISPR GTCTGGATCTGCAGGCAGGA GGG (reversed) Intronic
900094736 1:935758-935780 GTCTCGTTCTGCAGCCAGGACGG + Exonic
900839488 1:5036582-5036604 GTCTGTATCTGGAAGCATGAGGG - Intergenic
900971522 1:5994672-5994694 GTCTGGATTTGGAGCCTGGATGG + Intronic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904468642 1:30722621-30722643 GCCTGGGCCTGCAGTCAGGAAGG + Intronic
905015659 1:34776930-34776952 GTCTGGGGCTGCAGGCAGGGAGG - Intronic
905595672 1:39204574-39204596 GTCTGGCCTTGCAGGCAGGCTGG + Intronic
906230338 1:44157203-44157225 GTCTCGCTCTGCAGCCAGGCTGG + Intergenic
906290050 1:44613991-44614013 CTCTGGAGCTGCAAGGAGGAGGG + Intronic
907198641 1:52707315-52707337 GTTTTTATGTGCAGGCAGGAGGG - Intergenic
908518299 1:64915906-64915928 TTCTGGAGCTGCAGGGAAGAGGG - Intronic
908641136 1:66224687-66224709 GTCTTGATCTGCTGCCAGGATGG - Intronic
909566207 1:77056082-77056104 GTCTGGTGATACAGGCAGGATGG - Intronic
914811287 1:151030231-151030253 GTCTTGCTCTGTTGGCAGGATGG - Intronic
917125102 1:171680350-171680372 AAATGGATCTGCAGGCATGAGGG - Intergenic
922470159 1:225871773-225871795 GGATGAATTTGCAGGCAGGAAGG - Intronic
923429447 1:233905863-233905885 GTCTGTATCAGCAGGCAGGGCGG - Intronic
1062773908 10:129278-129300 GTCTGGCTCTGCTGCCAGGCTGG - Intergenic
1064462213 10:15546138-15546160 GGCTGCTTCTGCAGGTAGGATGG - Intronic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1067933161 10:50583665-50583687 GACTGGATCTGCCTTCAGGAGGG - Intronic
1068491654 10:57732030-57732052 GTTTGGCTCAGGAGGCAGGAGGG - Intergenic
1069807764 10:71136632-71136654 GTCTGGAGCTGCTGGGAGTAGGG - Intergenic
1071291108 10:84189790-84189812 GTCTGGCTCTGCACCCAGGCAGG - Intergenic
1071495094 10:86162658-86162680 GTCTGGATCTGGAGCCAGCAGGG + Intronic
1071564541 10:86665012-86665034 GCAGGGATCTGCAGGCAGCAGGG + Intronic
1072245857 10:93543208-93543230 GTTACCATCTGCAGGCAGGATGG - Intergenic
1074659354 10:115634804-115634826 GTCTAGATGTGCCGGCAAGATGG + Intronic
1075646539 10:124100557-124100579 GTCCGACTCTGAAGGCAGGAGGG + Intergenic
1076714161 10:132354812-132354834 GGCCGGATCTGGGGGCAGGATGG + Intronic
1079005852 11:16790700-16790722 GCCTAGAGCTGCAGGCAGAAGGG + Intronic
1084758910 11:71256067-71256089 GTGGGGAGCAGCAGGCAGGAGGG + Intergenic
1085076916 11:73599342-73599364 GTCTGGATCTATAGCCAGGCTGG + Intergenic
1085769736 11:79314078-79314100 GACTGGATTTGCAGTCATGAAGG + Intronic
1089009162 11:115118850-115118872 GTCTAGAGGCGCAGGCAGGATGG + Intergenic
1089681323 11:120120512-120120534 GTGGGGCTGTGCAGGCAGGAGGG - Intronic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1090198187 11:124835243-124835265 GTCTGGCTCTGCCGTCAGGCTGG + Intergenic
1092831661 12:12449888-12449910 GCCTGGATCTGCAGTGAGAAGGG - Intronic
1093604366 12:21072585-21072607 GTCTGGATCTGTAGCAAGGCTGG + Intronic
1093714213 12:22362984-22363006 CTCTGGAACTTCAGGAAGGAAGG + Intronic
1095374487 12:41509867-41509889 GTCTGCATCAGCAGGCAAGCTGG - Exonic
1096245420 12:49982359-49982381 TTCTGGAGCAGCAGGCTGGAGGG + Intronic
1097046901 12:56193757-56193779 GTATGGAACTGGAGGCAGAAAGG - Intergenic
1100096904 12:91051463-91051485 ATCTCGTTCTGCAGGCAGCATGG + Exonic
1100304637 12:93339147-93339169 GTCTTGCTCTGCAGCCAGGCTGG + Intergenic
1101895398 12:108752836-108752858 GTCTCGATCTGCATCCAGGCTGG + Intergenic
1102478304 12:113203053-113203075 GTCTTGCTCTGCAGCCAGGCTGG + Intronic
1102857151 12:116304083-116304105 ATCTGAGTCTGCAGGAAGGAGGG + Intergenic
1102872891 12:116427666-116427688 GTCTACGTGTGCAGGCAGGATGG + Intergenic
1103933882 12:124465161-124465183 GGCTGGGACTACAGGCAGGAGGG + Intronic
1104668306 12:130663099-130663121 AGCAGGTTCTGCAGGCAGGAGGG + Intronic
1105892061 13:24689020-24689042 GGAGGGATCTCCAGGCAGGATGG + Intronic
1108067271 13:46591077-46591099 ATCTGAATGTCCAGGCAGGAAGG - Intronic
1112258212 13:97853872-97853894 GTCTGGATGAGCAGGAGGGAGGG - Intergenic
1113420087 13:110164551-110164573 ATCTGGAGCGGGAGGCAGGAGGG + Intronic
1113490214 13:110685754-110685776 GTCAGGGTTTGCAGCCAGGATGG + Intronic
1115506351 14:34097758-34097780 GTCTGGAAATGCAGCCAGCAGGG - Intronic
1115639960 14:35328910-35328932 GTCTGGCTCTGTTGCCAGGATGG - Intergenic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1116317082 14:43410755-43410777 GTCTGTAGCTGCAGCCAGGAGGG + Intergenic
1118356395 14:65017383-65017405 GCCTGGATCTGAACGCTGGATGG + Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120403792 14:84068722-84068744 GTATGGAAATGCAGACAGGAGGG + Intergenic
1121031495 14:90662228-90662250 CTCTGAATCTGCAGGTAGGGAGG + Intronic
1121402029 14:93688423-93688445 AGCTGGAGCTGCAGGCAGAAGGG + Intronic
1121984246 14:98486575-98486597 CTCTGGATCTTCAGAAAGGAAGG + Intergenic
1122201061 14:100122949-100122971 GTCTGGAGCTGCGGGTGGGAAGG - Intronic
1122650559 14:103224048-103224070 GTCTGGAGCCGCAGCCTGGAGGG - Intergenic
1124269371 15:28266749-28266771 GTCAGGAACTGGAGGTAGGAAGG + Intronic
1125391211 15:39195112-39195134 CTCTGGATCTGCAGACAAGCAGG - Intergenic
1125607545 15:40949802-40949824 GCCTGGATCTGAAGGCAGCTGGG - Intergenic
1125723918 15:41858579-41858601 GTGAGGCCCTGCAGGCAGGAGGG - Intronic
1126451471 15:48813373-48813395 GTCTGGAGAAGAAGGCAGGAAGG + Intergenic
1127254181 15:57274620-57274642 GTCTCGCTCTGAAGGCAGCAAGG + Intronic
1127839699 15:62820391-62820413 ATCTGGATTTGCATGCATGAAGG - Intronic
1128603418 15:69016381-69016403 CACTGGAGCTGCAGGCAGCAAGG - Intronic
1129064364 15:72888863-72888885 GTCTGGGTCTGCAAGCAGCTTGG + Intergenic
1129268254 15:74406187-74406209 GTCTGGCACTGTAGCCAGGATGG + Intergenic
1129741938 15:77993530-77993552 GTCGGGTTCTGGGGGCAGGAAGG + Intronic
1130363437 15:83210813-83210835 ATCTGTCTCTGCAGCCAGGATGG + Intergenic
1130538346 15:84802809-84802831 CTCAGGATCTAAAGGCAGGAAGG - Exonic
1130763317 15:86843382-86843404 GTCTGGATGTTAAGGCAAGAAGG + Intronic
1131171425 15:90181470-90181492 GTCTTGCTCTGCAGCCAGGCTGG - Intronic
1132744941 16:1432655-1432677 CTCCGGATCTGAGGGCAGGAAGG - Intergenic
1133109883 16:3541686-3541708 GCCGGGCTCTGCAGGGAGGAAGG - Intronic
1133287704 16:4698256-4698278 GCCTGGGTCTGCCTGCAGGAAGG + Intronic
1134671436 16:16058574-16058596 GTCTGGAACTGCAGGAGAGATGG + Intronic
1134807999 16:17142009-17142031 CTCAGGAGCTGGAGGCAGGAGGG - Intronic
1135483100 16:22839400-22839422 TTCTGAAGCTCCAGGCAGGAAGG - Intronic
1136619151 16:31416497-31416519 GTCAGGGTCTGCAGGCTGAAGGG - Exonic
1137521050 16:49195715-49195737 GCCTGTATGTCCAGGCAGGAAGG - Intergenic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1138202746 16:55102120-55102142 GACTGGATCAGCAGGAGGGAAGG - Intergenic
1138439566 16:57026001-57026023 GGCTGCCTCTGCAGGCAGGCAGG - Exonic
1139563382 16:67757825-67757847 CTCTGGCACTGCAGGTAGGAAGG + Intronic
1141871309 16:86788599-86788621 CTCTAGATCTCCAGGCAGGGAGG - Intergenic
1143431376 17:6889302-6889324 GTCTTGATCTCTTGGCAGGATGG - Intronic
1143991421 17:10966553-10966575 GTTTGGATGTGCAGTAAGGATGG + Intergenic
1144757003 17:17685923-17685945 GTCTGGGGCGGCAGGGAGGAAGG - Intronic
1144826749 17:18109434-18109456 TTCTGGATCTGTGGTCAGGATGG + Intronic
1145404903 17:22580520-22580542 GTCTCGCTCTGCAGCCAGGCTGG - Intergenic
1146483815 17:33227363-33227385 TACTGGAGCTGCAGGCAGGAGGG - Intronic
1147001929 17:37369737-37369759 CTCTGTAACTGCAGGCTGGAGGG + Intronic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1148855563 17:50577256-50577278 GACTGCATCTGCACACAGGAGGG - Intronic
1149373287 17:56018246-56018268 ATCCCTATCTGCAGGCAGGAAGG + Intergenic
1149407425 17:56368056-56368078 CTCTGGATCTGATGGCAGAATGG - Intronic
1150821473 17:68437647-68437669 GTCTGCGTCTGCAGTCAAGATGG + Intronic
1153299585 18:3581175-3581197 CTCAGGATCTAAAGGCAGGAAGG - Intronic
1153519908 18:5941890-5941912 GTTTGGCTCTGTAGACAGGAGGG - Intergenic
1153754372 18:8264926-8264948 GTCTAGAGTTGCAGGCAGGCTGG + Intronic
1154384763 18:13883175-13883197 CTCAGGATCTGCAGGATGGATGG - Exonic
1155212987 18:23619146-23619168 GTCTGCAGCTCCAGGGAGGAGGG + Intronic
1155615676 18:27718488-27718510 GTCTGGAACTGCTGACATGAAGG - Intergenic
1156702625 18:39842778-39842800 GGCTGGATCTGCAGACAGGCTGG - Intergenic
1160185682 18:76674705-76674727 GGCTGCATCTGCAGGCTGGAGGG + Intergenic
1160695832 19:483859-483881 GCCTGGCTTTACAGGCAGGATGG - Intergenic
1160887552 19:1357899-1357921 CTCTGAAGATGCAGGCAGGAGGG - Intronic
1161105824 19:2443503-2443525 GGAGGGATCTGCTGGCAGGAGGG - Intronic
1161395804 19:4044279-4044301 GTGTGGACCTGCAGCCAGGCAGG - Intergenic
1161617774 19:5281740-5281762 CTCTGGAGCTGCTGGAAGGAAGG + Intronic
1161771422 19:6233152-6233174 GTCCGGCACTGCAGGCAGGCTGG - Intronic
1162015609 19:7845052-7845074 ATCTGGATCCCCAGGCAGCAGGG - Intronic
1162395444 19:10415904-10415926 GGCTGGAGCTGAGGGCAGGAAGG + Intronic
1162432352 19:10636589-10636611 GGCTGGCGTTGCAGGCAGGATGG + Intronic
1162495670 19:11022084-11022106 GTCTGCATCTGCATGGAGCAGGG + Intronic
1162750292 19:12825568-12825590 CTCTGGAGCTCCAGGGAGGAGGG + Exonic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1164245141 19:23421908-23421930 TTCTGGGTCTGAGGGCAGGAAGG - Intergenic
1164531069 19:29048624-29048646 TTCTGTATCTACAAGCAGGAAGG - Intergenic
1165066515 19:33232342-33232364 GTCAGGATCTGCATGCTGGGAGG + Intergenic
1166629313 19:44391122-44391144 GTCTGGCTCTGTAGCCAGGCTGG - Intronic
1167773999 19:51542997-51543019 GTCAGTTTCTGCAGGAAGGAAGG - Intergenic
1167852933 19:52215764-52215786 TTCTGGAGCTGCAGACAGGAAGG - Exonic
1168406869 19:56115013-56115035 GCCTGGATCTGCAGGCTAGGTGG + Intronic
924988955 2:294925-294947 GTCTGCACCTCCAGGAAGGAAGG + Intergenic
925055906 2:857199-857221 GTCTGTTTCTGCAGGCAGCTTGG + Intergenic
925338489 2:3115904-3115926 GTCTGGTCCTGCAGGCAGGACGG - Intergenic
926210119 2:10863147-10863169 GACTGGATGTGCAGGCCAGAGGG + Intergenic
926514236 2:13821301-13821323 GTGTGGTTCTGCAGGCAGCTTGG + Intergenic
926757175 2:16245442-16245464 GTCAGGCTCCGCAGGCAGTAGGG - Intergenic
927108491 2:19847588-19847610 TTCAGGATCTGCAGCCAGAAAGG - Intergenic
928273907 2:29881541-29881563 GTCTGGACAAGCTGGCAGGAGGG - Intronic
928279291 2:29929936-29929958 ATCTGGATATGCAGTCAGGTGGG + Intergenic
928323390 2:30301534-30301556 CTCTGGGTCTGCTGTCAGGAGGG + Intronic
928655967 2:33452464-33452486 GCCTGAGTCAGCAGGCAGGAAGG + Intronic
931808303 2:65829502-65829524 GTCAGGGACTGCAGGTAGGAAGG - Intergenic
932670216 2:73731049-73731071 GACTGGATCCCCAGGCAGGCTGG - Intronic
932714843 2:74093560-74093582 GTCTGGGGCTGAAGGAAGGACGG + Exonic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
935297448 2:101663051-101663073 GTCTGGCTCTGTAGCCAGGCTGG + Intergenic
936975836 2:118221527-118221549 GTCTTTATCACCAGGCAGGAAGG + Intergenic
937067519 2:119029029-119029051 GGCAGGATGTGCAGTCAGGACGG + Intergenic
937266214 2:120616114-120616136 GGCTGGTTCTGCTGGCTGGAGGG - Intergenic
937454321 2:122028072-122028094 CTCTGATTCTGCAGGCATGAGGG + Intergenic
938388203 2:130882777-130882799 GTCTGTGGGTGCAGGCAGGAGGG + Intronic
938951388 2:136257944-136257966 GTCTGGATCTGTAGTCAGAGGGG - Intergenic
942427158 2:175872131-175872153 GTCTGAAGCTGCTGACAGGACGG - Intergenic
944230646 2:197388820-197388842 GTCAAGATTTGTAGGCAGGAGGG - Intergenic
945488828 2:210430471-210430493 GAATGGATCTGCAGTCAGGGAGG + Intergenic
945856181 2:215072546-215072568 GTCTGGACATGCAGGAAGGTGGG - Intronic
946158042 2:217819873-217819895 ACCTGGAGCTGCAGGCTGGAAGG + Intronic
946222696 2:218242084-218242106 GGCTGGATGTGCATGCTGGAAGG - Intronic
946306064 2:218857694-218857716 GGCTGGGTCTGGAGGCAGCAGGG + Intergenic
946369889 2:219274394-219274416 GGCTGGTTCAGCAGACAGGAAGG - Intronic
947753955 2:232547481-232547503 GACAGGATATGCTGGCAGGAGGG + Intergenic
948107668 2:235428164-235428186 GGCAGGATCAGCAGGGAGGATGG + Intergenic
948345519 2:237294105-237294127 GGCTGAATTTGCAGGGAGGAGGG + Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948938823 2:241186101-241186123 GGCTGCACCTGCAGACAGGAAGG + Intergenic
1171231633 20:23491597-23491619 GGCTGGAGCTGTGGGCAGGATGG - Exonic
1171383617 20:24752369-24752391 GTCTGGAGCTGCAGGCTCCAGGG - Intergenic
1171460705 20:25296478-25296500 GGCGGGATCTGCAGGTCGGAGGG - Exonic
1172170830 20:32930974-32930996 TCCTGGATTAGCAGGCAGGAAGG - Intronic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1174760863 20:53206187-53206209 GTCTGGCTCTGCCGTCAGGCTGG - Intronic
1175675771 20:60945593-60945615 GCCTGGGTCTGCAGGCAGTTTGG - Intergenic
1175858225 20:62134056-62134078 GTCTGACTCTGGGGGCAGGAGGG + Intronic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1176015368 20:62928362-62928384 CTCTGGACTTGCAGGAAGGAAGG - Intronic
1177481525 21:21696326-21696348 CTCTGGCTCTGCTGCCAGGATGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1180170708 21:46056858-46056880 GTCAGGGCCTGCAGGCTGGATGG + Intergenic
1180612097 22:17104711-17104733 GGCTGGATCTGCGGGCAGAGAGG - Exonic
1181029293 22:20142219-20142241 GTCTGAGTCTGCAGGCATGTAGG + Intronic
1181513945 22:23401099-23401121 GTCTGAGTCTGCAGGCATGCAGG - Intergenic
1181823310 22:25493113-25493135 CTCTGCATCTGCAAACAGGAAGG - Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1184466194 22:44669851-44669873 GACTGGATCTGGAGGCGGGAGGG + Intronic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
949457055 3:4250147-4250169 GTCTTGATCTGTTGGCTGGAGGG - Intronic
949693533 3:6667791-6667813 GCCTGGATGTCCAGGCAGAAGGG + Intergenic
951736519 3:25871555-25871577 GCCTGCATAGGCAGGCAGGAGGG - Intronic
952422780 3:33146304-33146326 GTTTGGTTCTGCAGGCTGGTGGG + Exonic
952835101 3:37595694-37595716 GTTTGGGTTTGTAGGCAGGATGG + Intronic
953473511 3:43186194-43186216 GTCTGGATCTTGGGGCAGGAAGG - Intergenic
953637427 3:44674932-44674954 GGCTGTATCTGCAGGCAAGTGGG - Intergenic
954633149 3:52057545-52057567 GTGTCGATTTGCAGGCAGGCGGG + Intergenic
955216331 3:56987476-56987498 GGCCCAATCTGCAGGCAGGAGGG + Intronic
956267940 3:67418713-67418735 GGTTGGAACAGCAGGCAGGATGG - Intronic
956830607 3:73043917-73043939 GTCTGGAACTGTGGGGAGGAAGG - Intronic
960493354 3:118345489-118345511 GTCTTGCTCTGCTGCCAGGATGG + Intergenic
960896853 3:122514700-122514722 GCCCGGATCTGCCGGCGGGAGGG + Intronic
961086883 3:124075926-124075948 GTCAGGATCTGCACCAAGGACGG + Intergenic
964514517 3:157493370-157493392 GGCTGGATCTGAGGGAAGGATGG + Intronic
964778171 3:160303914-160303936 GTTTGATTCTGCAGGCAGAAAGG - Exonic
965457439 3:168920753-168920775 GTCTCGCTCTGCAGCCAGGCTGG - Intergenic
966128301 3:176606298-176606320 GGATGGATCTGCAGGTGGGACGG + Intergenic
966758599 3:183394408-183394430 GTCTGGTTGTGGAGGTAGGAGGG - Intronic
968122793 3:196137686-196137708 GTCTGGTTCTGTTGCCAGGATGG + Intergenic
969461828 4:7333113-7333135 GTGTGGCCGTGCAGGCAGGAAGG + Intronic
969593186 4:8133426-8133448 ATATGGACCGGCAGGCAGGAGGG - Intronic
969680312 4:8639677-8639699 GGCTGGAGCAGCAGGAAGGAAGG + Intergenic
970477020 4:16434042-16434064 GTTTGAATCTGCAAGAAGGAAGG - Intergenic
970927584 4:21470901-21470923 GTTTGGATCAGCAGCCAGGATGG + Intronic
973675906 4:53262790-53262812 GTCTAGATCTGTAGCCAGGCTGG + Intronic
974862962 4:67545682-67545704 GGGTGGGTCTGCAGGCTGGAGGG - Intergenic
975373287 4:73612993-73613015 ATCTGGACCTGCAGTGAGGAGGG - Intronic
977011111 4:91634390-91634412 ATATGGAGCTGCAGGAAGGAAGG + Intergenic
980516487 4:133868961-133868983 GTTTGCATCTGCAGGCTGGATGG - Intergenic
985288075 4:188357362-188357384 GTCTCGATCTCCAGGATGGAGGG - Intergenic
985644240 5:1077617-1077639 GGAGGGACCTGCAGGCAGGAGGG + Intronic
985800302 5:2001458-2001480 TTCTGCAGCTGCAAGCAGGAGGG + Intergenic
985820581 5:2157462-2157484 ATTCGGAGCTGCAGGCAGGAGGG - Intergenic
986780233 5:11058523-11058545 GCCTGGATGTCCAGGCAGAAGGG + Intronic
989148237 5:38270005-38270027 GTCTAGCTCTGCAGCCAGGAGGG + Intronic
989554175 5:42772619-42772641 GTCTCGTTCTGCAGCCAGGCTGG - Intronic
990908385 5:60827872-60827894 TTCTGGGTGTGCAGGAAGGATGG - Intronic
991216325 5:64160523-64160545 GTCTGGAGATGGAGGCTGGATGG - Intergenic
991633956 5:68684393-68684415 GTATGGTTCTGCAGTCAGCAGGG - Intergenic
995239524 5:109870347-109870369 GTCTGGGCCAGCAGGCTGGAGGG - Intergenic
995399758 5:111727682-111727704 GTCAGGGTCTGCAAGTAGGAAGG - Intronic
996735175 5:126751610-126751632 GTCTTGCTCTGCCGGCAGGCTGG - Intergenic
998909216 5:146940249-146940271 GCCTGAATCTGCAGCCAGGAGGG - Intronic
1000098795 5:157994721-157994743 GTCTGAATGAGCAGGCAGAAGGG + Intergenic
1000232316 5:159327602-159327624 GTCTGATTCAGCAGGCATGAGGG + Intronic
1001228703 5:169967429-169967451 ATCTGGATGTGCAGGTTGGAGGG + Intronic
1001308164 5:170590827-170590849 GTCTGCATCTGCATGCATGCAGG + Intronic
1002418195 5:179131868-179131890 GGCAGGGTCTGCAGGCAGCAGGG - Intronic
1002679405 5:180949368-180949390 TTCTCCATCTGCAGGCAGGATGG - Intronic
1003236742 6:4301700-4301722 GACTGGATCTGGAGGCTGGTGGG - Intergenic
1003385771 6:5666030-5666052 GGCAGGATCTGGAGGGAGGAAGG + Intronic
1005154216 6:22785194-22785216 GGATGAATCTGCAGGCAGGCAGG + Intergenic
1007238250 6:40406415-40406437 GCCTGGATCAGCGGGCAGGCTGG - Intronic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1008231352 6:48987925-48987947 GTCTGGATCTCTAGCAAGGATGG - Intergenic
1008494866 6:52122829-52122851 GTCTAGATCTGCAGGCATCAGGG - Intergenic
1010453083 6:76025649-76025671 CTCTGGATATGCAGGCTTGAGGG - Intronic
1011697344 6:89924265-89924287 GTCAGGATCTGCAGGAACCAGGG + Intergenic
1016936216 6:149451029-149451051 GGCTGGAGCTGCAGGCCGGGCGG + Exonic
1017095392 6:150800267-150800289 GGCTGGATCTTCCAGCAGGAAGG + Intronic
1018172946 6:161155867-161155889 GATTGGTTCTGCAGCCAGGAAGG + Intronic
1018817273 6:167343028-167343050 CTCTCAGTCTGCAGGCAGGATGG + Intronic
1019731878 7:2633156-2633178 ATCCGGATCTCTAGGCAGGAAGG - Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1021190392 7:17613424-17613446 GTCTGGGTCAGCAGGTAGGCGGG + Intergenic
1022523973 7:31025632-31025654 CTCAGGAGCTGCAGGCAGGGTGG + Intergenic
1023747208 7:43332535-43332557 GTCTGGACCTGCAGCCAGGTGGG + Intronic
1023913613 7:44572304-44572326 GTCTGGAGCTGCAGACATGGGGG - Intronic
1023923458 7:44647825-44647847 GCCAGGATGTCCAGGCAGGAGGG + Intronic
1024573094 7:50741424-50741446 GTCTGCAGCTGCATGCAGGCTGG - Intronic
1025664536 7:63575184-63575206 GTCTCGCTCTGTAGCCAGGATGG + Intergenic
1027446184 7:78275387-78275409 ATCTGGGTCTGCTGGCAAGATGG - Intronic
1030376926 7:108762884-108762906 GTCTGGATGTGGAAGCAGGTAGG + Intergenic
1031133585 7:117861540-117861562 GTCTGGGTGTGCAGGCAGGCTGG - Intronic
1033174004 7:139108812-139108834 GTCTGGAGGTGCCGGAAGGAAGG + Intronic
1033449460 7:141449626-141449648 GTCAGAATGTGCAGACAGGAGGG + Intronic
1035016346 7:155769691-155769713 GTCTGGTTCTGACTGCAGGAAGG + Intronic
1035555424 8:564038-564060 GCCTGGATCTGCGGTCAGGCTGG - Intergenic
1035600364 8:893682-893704 GGATAGACCTGCAGGCAGGAGGG - Intergenic
1035659760 8:1338466-1338488 GCCTGGGTCTGGGGGCAGGAAGG + Intergenic
1036650300 8:10637940-10637962 CCCTGGGGCTGCAGGCAGGAGGG - Intronic
1039414668 8:37383653-37383675 GCCTGGATTTGCATGGAGGAAGG + Intergenic
1039608171 8:38900035-38900057 GACTGGATTTGCAGGAAGGAGGG - Intergenic
1040770107 8:50963699-50963721 GTCAGGAACTTGAGGCAGGATGG + Intergenic
1040770189 8:50965058-50965080 GTCAGGAACTTGAGGCAGGATGG + Intergenic
1044771862 8:95644555-95644577 GCCTGGATCTCCAGTGAGGAAGG + Intergenic
1045412708 8:101934569-101934591 GTCGGGAGCTTCAGGAAGGAGGG + Intronic
1046188607 8:110758640-110758662 GTCTGGATCTGTTGCCAGGCTGG - Intergenic
1047599450 8:126411525-126411547 TTCTGGGAGTGCAGGCAGGAGGG + Intergenic
1047766302 8:127992719-127992741 CCCTGGATATGCAGACAGGATGG + Intergenic
1047976703 8:130137890-130137912 GTCAGCTTCTGCAGGAAGGAGGG - Intronic
1048889256 8:138933199-138933221 GTCTGGCTCTGCTGTCAGGCTGG - Intergenic
1049365946 8:142236974-142236996 GTCCAGACCTGAAGGCAGGAAGG + Intronic
1049529668 8:143148074-143148096 TTCTGGAGCTTCAGCCAGGAGGG + Intergenic
1050622301 9:7467167-7467189 GACTGGATCTCCAGAGAGGAGGG - Intergenic
1050991964 9:12167032-12167054 CTCTGGATCAGAAGGCAGGATGG + Intergenic
1051638752 9:19204900-19204922 GTCTGGCTCTGCACCCAGGCTGG + Intergenic
1052998504 9:34564545-34564567 GTCTGGGTCTCAAGGAAGGAGGG + Intronic
1053434558 9:38066806-38066828 GACTGGATGTCCAGACAGGAGGG - Intronic
1053606797 9:39668240-39668262 GTCTGGAACTGCACTGAGGATGG + Intergenic
1054246739 9:62674162-62674184 GTCTGGAACTGCACTGAGGATGG - Intergenic
1054560860 9:66708696-66708718 GTCTGGAACTGCACTGAGGATGG - Intergenic
1056066511 9:82940894-82940916 CTCTGGATCTCCAGGTAGGATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057810214 9:98251747-98251769 CCCTGGGTGTGCAGGCAGGAGGG + Intronic
1058474815 9:105322194-105322216 TTCTGGTTTTGAAGGCAGGAAGG + Intronic
1060683416 9:125585931-125585953 ATCGGGATCTGCCAGCAGGAAGG + Intronic
1060932226 9:127496333-127496355 GACTGGATCTTCAGACTGGAGGG + Intronic
1062209643 9:135356700-135356722 GTCTGGGCCTGCAGGTGGGAAGG + Intergenic
1062380668 9:136285206-136285228 GTCTGGAGCAGCAGGCAAGAGGG + Intronic
1062393923 9:136345023-136345045 CTCTGGATCTGCAGTGAGGCGGG + Intronic
1062685243 9:137809372-137809394 GACTGGCTCTGCAGGTAGGCAGG - Intronic
1186720672 X:12300365-12300387 GTAAGGCTCTGGAGGCAGGATGG + Intronic
1188062041 X:25612809-25612831 GTATGGCTCTGGAGGCTGGAGGG + Intergenic
1190190693 X:48274548-48274570 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1190190699 X:48274588-48274610 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1192240660 X:69325089-69325111 GTCTGGAGCTCCAGGCTGGCAGG - Intergenic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1199897359 X:152137621-152137643 CTCTGGAACCCCAGGCAGGACGG - Intronic
1201646304 Y:16236085-16236107 AGCTGGTTCTGCAAGCAGGAAGG + Intergenic
1201656509 Y:16349232-16349254 AGCTGGTTCTGCAAGCAGGAAGG - Intergenic