ID: 1185226985

View in Genome Browser
Species Human (GRCh38)
Location 22:49658745-49658767
Sequence AGGCGTACCCTCTCCGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185226977_1185226985 21 Left 1185226977 22:49658701-49658723 CCTCTCTCTTTTTTATGAGGAAC No data
Right 1185226985 22:49658745-49658767 AGGCGTACCCTCTCCGGGATGGG No data
1185226975_1185226985 28 Left 1185226975 22:49658694-49658716 CCTCAAACCTCTCTCTTTTTTAT No data
Right 1185226985 22:49658745-49658767 AGGCGTACCCTCTCCGGGATGGG No data
1185226980_1185226985 -3 Left 1185226980 22:49658725-49658747 CCGGTTAATTACAGGATTTAAGG No data
Right 1185226985 22:49658745-49658767 AGGCGTACCCTCTCCGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185226985 Original CRISPR AGGCGTACCCTCTCCGGGAT GGG Intergenic