ID: 1185227247

View in Genome Browser
Species Human (GRCh38)
Location 22:49660104-49660126
Sequence AAGCGTGGCATCAGGATCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227247_1185227253 7 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227253 22:49660134-49660156 ATCCTTGACGGGGAGAAACGCGG No data
1185227247_1185227251 -4 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227251 22:49660123-49660145 GCTTGTTTCAAATCCTTGACGGG No data
1185227247_1185227257 19 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data
1185227247_1185227256 9 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227256 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
1185227247_1185227254 8 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227247_1185227258 29 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data
1185227247_1185227250 -5 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227250 22:49660122-49660144 CGCTTGTTTCAAATCCTTGACGG No data
1185227247_1185227252 -3 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227252 22:49660124-49660146 CTTGTTTCAAATCCTTGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227247 Original CRISPR AAGCGTGGCATCAGGATCCG AGG (reversed) Intergenic
No off target data available for this crispr