ID: 1185227248

View in Genome Browser
Species Human (GRCh38)
Location 22:49660112-49660134
Sequence TTTGAAACAAGCGTGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227248_1185227258 21 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data
1185227248_1185227254 0 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227248_1185227260 28 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data
1185227248_1185227253 -1 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227253 22:49660134-49660156 ATCCTTGACGGGGAGAAACGCGG No data
1185227248_1185227257 11 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data
1185227248_1185227256 1 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227256 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227248 Original CRISPR TTTGAAACAAGCGTGGCATC AGG (reversed) Intergenic