ID: 1185227249

View in Genome Browser
Species Human (GRCh38)
Location 22:49660119-49660141
Sequence TCAAGGATTTGAAACAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227249_1185227260 21 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data
1185227249_1185227254 -7 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227249_1185227257 4 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data
1185227249_1185227256 -6 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227256 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
1185227249_1185227253 -8 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227253 22:49660134-49660156 ATCCTTGACGGGGAGAAACGCGG No data
1185227249_1185227258 14 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227249 Original CRISPR TCAAGGATTTGAAACAAGCG TGG (reversed) Intergenic
No off target data available for this crispr