ID: 1185227254

View in Genome Browser
Species Human (GRCh38)
Location 22:49660135-49660157
Sequence TCCTTGACGGGGAGAAACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227248_1185227254 0 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227249_1185227254 -7 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227247_1185227254 8 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227244_1185227254 29 Left 1185227244 22:49660083-49660105 CCCTGAAGGACGACAAGGCTGCC No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data
1185227245_1185227254 28 Left 1185227245 22:49660084-49660106 CCTGAAGGACGACAAGGCTGCCT No data
Right 1185227254 22:49660135-49660157 TCCTTGACGGGGAGAAACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227254 Original CRISPR TCCTTGACGGGGAGAAACGC GGG Intergenic
No off target data available for this crispr