ID: 1185227255

View in Genome Browser
Species Human (GRCh38)
Location 22:49660136-49660158
Sequence CCCCGCGTTTCTCCCCGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227255_1185227260 4 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data
1185227255_1185227264 17 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227264 22:49660176-49660198 AGGTCACCGGTTCCCACTCTGGG No data
1185227255_1185227263 16 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227263 22:49660175-49660197 CAGGTCACCGGTTCCCACTCTGG No data
1185227255_1185227266 24 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227266 22:49660183-49660205 CGGTTCCCACTCTGGGATTCAGG No data
1185227255_1185227258 -3 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227255 Original CRISPR CCCCGCGTTTCTCCCCGTCA AGG (reversed) Intergenic