ID: 1185227257

View in Genome Browser
Species Human (GRCh38)
Location 22:49660146-49660168
Sequence GAGAAACGCGGGGCGCCACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227247_1185227257 19 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data
1185227248_1185227257 11 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data
1185227249_1185227257 4 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227257 22:49660146-49660168 GAGAAACGCGGGGCGCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227257 Original CRISPR GAGAAACGCGGGGCGCCACG CGG Intergenic