ID: 1185227258 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:49660156-49660178 |
| Sequence | GGGCGCCACGCGGCACCTCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185227247_1185227258 | 29 | Left | 1185227247 | 22:49660104-49660126 | CCTCGGATCCTGATGCCACGCTT | No data | ||
| Right | 1185227258 | 22:49660156-49660178 | GGGCGCCACGCGGCACCTCCAGG | No data | ||||
| 1185227248_1185227258 | 21 | Left | 1185227248 | 22:49660112-49660134 | CCTGATGCCACGCTTGTTTCAAA | No data | ||
| Right | 1185227258 | 22:49660156-49660178 | GGGCGCCACGCGGCACCTCCAGG | No data | ||||
| 1185227255_1185227258 | -3 | Left | 1185227255 | 22:49660136-49660158 | CCTTGACGGGGAGAAACGCGGGG | No data | ||
| Right | 1185227258 | 22:49660156-49660178 | GGGCGCCACGCGGCACCTCCAGG | No data | ||||
| 1185227249_1185227258 | 14 | Left | 1185227249 | 22:49660119-49660141 | CCACGCTTGTTTCAAATCCTTGA | No data | ||
| Right | 1185227258 | 22:49660156-49660178 | GGGCGCCACGCGGCACCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185227258 | Original CRISPR | GGGCGCCACGCGGCACCTCC AGG | Intergenic | ||