ID: 1185227258

View in Genome Browser
Species Human (GRCh38)
Location 22:49660156-49660178
Sequence GGGCGCCACGCGGCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227255_1185227258 -3 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data
1185227249_1185227258 14 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data
1185227247_1185227258 29 Left 1185227247 22:49660104-49660126 CCTCGGATCCTGATGCCACGCTT No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data
1185227248_1185227258 21 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227258 22:49660156-49660178 GGGCGCCACGCGGCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227258 Original CRISPR GGGCGCCACGCGGCACCTCC AGG Intergenic
No off target data available for this crispr