ID: 1185227260

View in Genome Browser
Species Human (GRCh38)
Location 22:49660163-49660185
Sequence ACGCGGCACCTCCAGGTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185227249_1185227260 21 Left 1185227249 22:49660119-49660141 CCACGCTTGTTTCAAATCCTTGA No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data
1185227248_1185227260 28 Left 1185227248 22:49660112-49660134 CCTGATGCCACGCTTGTTTCAAA No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data
1185227255_1185227260 4 Left 1185227255 22:49660136-49660158 CCTTGACGGGGAGAAACGCGGGG No data
Right 1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185227260 Original CRISPR ACGCGGCACCTCCAGGTCAC CGG Intergenic
No off target data available for this crispr