ID: 1185227263 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:49660175-49660197 |
Sequence | CAGGTCACCGGTTCCCACTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185227259_1185227263 | -9 | Left | 1185227259 | 22:49660161-49660183 | CCACGCGGCACCTCCAGGTCACC | No data | ||
Right | 1185227263 | 22:49660175-49660197 | CAGGTCACCGGTTCCCACTCTGG | No data | ||||
1185227255_1185227263 | 16 | Left | 1185227255 | 22:49660136-49660158 | CCTTGACGGGGAGAAACGCGGGG | No data | ||
Right | 1185227263 | 22:49660175-49660197 | CAGGTCACCGGTTCCCACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185227263 | Original CRISPR | CAGGTCACCGGTTCCCACTC TGG | Intergenic | ||