ID: 1185229415

View in Genome Browser
Species Human (GRCh38)
Location 22:49671554-49671576
Sequence GCTTGGGGGGGCATCTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185229415_1185229427 27 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229427 22:49671604-49671626 TCTCCAGTTCTAAAGCGGACGGG No data
1185229415_1185229429 29 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229429 22:49671606-49671628 TCCAGTTCTAAAGCGGACGGGGG No data
1185229415_1185229428 28 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229428 22:49671605-49671627 CTCCAGTTCTAAAGCGGACGGGG No data
1185229415_1185229425 22 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229425 22:49671599-49671621 CTCTCTCTCCAGTTCTAAAGCGG No data
1185229415_1185229426 26 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229426 22:49671603-49671625 CTCTCCAGTTCTAAAGCGGACGG No data
1185229415_1185229431 30 Left 1185229415 22:49671554-49671576 CCAGATCAGATGCCCCCCCAAGC No data
Right 1185229431 22:49671607-49671629 CCAGTTCTAAAGCGGACGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185229415 Original CRISPR GCTTGGGGGGGCATCTGATC TGG (reversed) Intergenic
No off target data available for this crispr