ID: 1185236630

View in Genome Browser
Species Human (GRCh38)
Location 22:49717314-49717336
Sequence CTGTGTAAACAGTTGTTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185236627_1185236630 3 Left 1185236627 22:49717288-49717310 CCGTGACACCGAGTCCAGTGTAA No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236623_1185236630 7 Left 1185236623 22:49717284-49717306 CCCCCCGTGACACCGAGTCCAGT No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236624_1185236630 6 Left 1185236624 22:49717285-49717307 CCCCCGTGACACCGAGTCCAGTG No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236628_1185236630 -5 Left 1185236628 22:49717296-49717318 CCGAGTCCAGTGTAAATTCTGTG No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236622_1185236630 12 Left 1185236622 22:49717279-49717301 CCAGGCCCCCCGTGACACCGAGT No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236625_1185236630 5 Left 1185236625 22:49717286-49717308 CCCCGTGACACCGAGTCCAGTGT No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data
1185236626_1185236630 4 Left 1185236626 22:49717287-49717309 CCCGTGACACCGAGTCCAGTGTA No data
Right 1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185236630 Original CRISPR CTGTGTAAACAGTTGTTACA CGG Intergenic
No off target data available for this crispr