ID: 1185238499

View in Genome Browser
Species Human (GRCh38)
Location 22:49728081-49728103
Sequence GGGGACTGCATGTTTGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185238488_1185238499 24 Left 1185238488 22:49728034-49728056 CCGATAGCTGTCTGTGAGCTCTG No data
Right 1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG No data
1185238492_1185238499 0 Left 1185238492 22:49728058-49728080 CCCGGCAATTCGGAAGTGGCCAT No data
Right 1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG No data
1185238493_1185238499 -1 Left 1185238493 22:49728059-49728081 CCGGCAATTCGGAAGTGGCCATG No data
Right 1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185238499 Original CRISPR GGGGACTGCATGTTTGGAAT AGG Intergenic
No off target data available for this crispr