ID: 1185240107

View in Genome Browser
Species Human (GRCh38)
Location 22:49737800-49737822
Sequence CCATTCCCACATATACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185240102_1185240107 3 Left 1185240102 22:49737774-49737796 CCCACATACACAAAGAGGAGAGG No data
Right 1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG No data
1185240100_1185240107 8 Left 1185240100 22:49737769-49737791 CCATTCCCACATACACAAAGAGG No data
Right 1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG No data
1185240104_1185240107 2 Left 1185240104 22:49737775-49737797 CCACATACACAAAGAGGAGAGGG No data
Right 1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185240107 Original CRISPR CCATTCCCACATATACAGAG AGG Intergenic
No off target data available for this crispr