ID: 1185242915

View in Genome Browser
Species Human (GRCh38)
Location 22:49755981-49756003
Sequence GGATGGGCCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185242915_1185242922 13 Left 1185242915 22:49755981-49756003 CCTCAATTTGCATTGGCCCATCC No data
Right 1185242922 22:49756017-49756039 AATTGAAAGTGGGTTCTCATGGG No data
1185242915_1185242920 3 Left 1185242915 22:49755981-49756003 CCTCAATTTGCATTGGCCCATCC No data
Right 1185242920 22:49756007-49756029 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465
1185242915_1185242921 12 Left 1185242915 22:49755981-49756003 CCTCAATTTGCATTGGCCCATCC No data
Right 1185242921 22:49756016-49756038 TAATTGAAAGTGGGTTCTCATGG No data
1185242915_1185242919 2 Left 1185242915 22:49755981-49756003 CCTCAATTTGCATTGGCCCATCC No data
Right 1185242919 22:49756006-49756028 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185242915 Original CRISPR GGATGGGCCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr