ID: 1185244453

View in Genome Browser
Species Human (GRCh38)
Location 22:49765735-49765757
Sequence CAGGCCCACCTGCAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185244453_1185244467 22 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244467 22:49765780-49765802 GCTGGCAGCCCCTGTGGGGAGGG No data
1185244453_1185244463 16 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244463 22:49765774-49765796 GGCAGGGCTGGCAGCCCCTGTGG No data
1185244453_1185244465 18 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244465 22:49765776-49765798 CAGGGCTGGCAGCCCCTGTGGGG No data
1185244453_1185244468 25 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244468 22:49765783-49765805 GGCAGCCCCTGTGGGGAGGGAGG No data
1185244453_1185244466 21 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244466 22:49765779-49765801 GGCTGGCAGCCCCTGTGGGGAGG No data
1185244453_1185244457 -5 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244457 22:49765753-49765775 GCCTGTAGCAGCTGCACCTGAGG No data
1185244453_1185244464 17 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244464 22:49765775-49765797 GCAGGGCTGGCAGCCCCTGTGGG No data
1185244453_1185244459 -1 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244459 22:49765757-49765779 GTAGCAGCTGCACCTGAGGCAGG No data
1185244453_1185244460 0 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244460 22:49765758-49765780 TAGCAGCTGCACCTGAGGCAGGG No data
1185244453_1185244461 4 Left 1185244453 22:49765735-49765757 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244461 22:49765762-49765784 AGCTGCACCTGAGGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185244453 Original CRISPR CAGGCCCACCTGCAGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr