ID: 1185244475

View in Genome Browser
Species Human (GRCh38)
Location 22:49765806-49765828
Sequence CAGGCCCACCTGCAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185244475_1185244486 17 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244486 22:49765846-49765868 GCAGGGCTGGCAGCCCCTGTGGG No data
1185244475_1185244488 21 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244488 22:49765850-49765872 GGCTGGCAGCCCCTGTGGGGAGG No data
1185244475_1185244483 4 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244483 22:49765833-49765855 AGCTGCACCTGAGGCAGGGCTGG No data
1185244475_1185244479 -5 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244479 22:49765824-49765846 GCCTGTAGCAGCTGCACCTGAGG No data
1185244475_1185244489 22 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244489 22:49765851-49765873 GCTGGCAGCCCCTGTGGGGAGGG No data
1185244475_1185244481 -1 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244481 22:49765828-49765850 GTAGCAGCTGCACCTGAGGCAGG No data
1185244475_1185244485 16 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244485 22:49765845-49765867 GGCAGGGCTGGCAGCCCCTGTGG No data
1185244475_1185244487 18 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244487 22:49765847-49765869 CAGGGCTGGCAGCCCCTGTGGGG No data
1185244475_1185244482 0 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244482 22:49765829-49765851 TAGCAGCTGCACCTGAGGCAGGG No data
1185244475_1185244490 25 Left 1185244475 22:49765806-49765828 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244490 22:49765854-49765876 GGCAGCCCCTGTGGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185244475 Original CRISPR CAGGCCCACCTGCAGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr