ID: 1185244497

View in Genome Browser
Species Human (GRCh38)
Location 22:49765877-49765899
Sequence CAGGCCCACCTGCAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185244497_1185244508 16 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244508 22:49765916-49765938 GGCAGGGCTGGCGGCTCCTGTGG No data
1185244497_1185244506 7 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244506 22:49765907-49765929 TGCACCTGAGGCAGGGCTGGCGG No data
1185244497_1185244503 -1 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244503 22:49765899-49765921 GTAGCAGCTGCACCTGAGGCAGG No data
1185244497_1185244505 4 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244505 22:49765904-49765926 AGCTGCACCTGAGGCAGGGCTGG No data
1185244497_1185244501 -5 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244501 22:49765895-49765917 GCCTGTAGCAGCTGCACCTGAGG No data
1185244497_1185244510 18 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244510 22:49765918-49765940 CAGGGCTGGCGGCTCCTGTGGGG No data
1185244497_1185244511 25 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244511 22:49765925-49765947 GGCGGCTCCTGTGGGGAGTGTGG No data
1185244497_1185244509 17 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244509 22:49765917-49765939 GCAGGGCTGGCGGCTCCTGTGGG No data
1185244497_1185244504 0 Left 1185244497 22:49765877-49765899 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244504 22:49765900-49765922 TAGCAGCTGCACCTGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185244497 Original CRISPR CAGGCCCACCTGCAGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr