ID: 1185244516

View in Genome Browser
Species Human (GRCh38)
Location 22:49765948-49765970
Sequence CAGGCCCACCTGCAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185244516_1185244528 17 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244528 22:49765988-49766010 CCCGGGCTGGTGGCCCCTGTGGG No data
1185244516_1185244531 21 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244531 22:49765992-49766014 GGCTGGTGGCCCCTGTGGGGAGG No data
1185244516_1185244533 25 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244533 22:49765996-49766018 GGTGGCCCCTGTGGGGAGGGAGG No data
1185244516_1185244526 16 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244526 22:49765987-49766009 GCCCGGGCTGGTGGCCCCTGTGG No data
1185244516_1185244521 -1 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244521 22:49765970-49765992 GTAGCAGCTGCACCTGAGCCCGG No data
1185244516_1185244522 0 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244522 22:49765971-49765993 TAGCAGCTGCACCTGAGCCCGGG No data
1185244516_1185244530 18 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244530 22:49765989-49766011 CCGGGCTGGTGGCCCCTGTGGGG No data
1185244516_1185244523 4 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244523 22:49765975-49765997 AGCTGCACCTGAGCCCGGGCTGG No data
1185244516_1185244524 7 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244524 22:49765978-49766000 TGCACCTGAGCCCGGGCTGGTGG No data
1185244516_1185244532 22 Left 1185244516 22:49765948-49765970 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244532 22:49765993-49766015 GCTGGTGGCCCCTGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185244516 Original CRISPR CAGGCCCACCTGCAGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr