ID: 1185244540

View in Genome Browser
Species Human (GRCh38)
Location 22:49766019-49766041
Sequence CAGGCCCACCTGCAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185244540_1185244549 5 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244549 22:49766047-49766069 GCTGCACCTGAGGCAGGGTTGGG No data
1185244540_1185244554 23 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244554 22:49766065-49766087 TTGGGAGGAAATGGCCACCCGGG No data
1185244540_1185244550 8 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244550 22:49766050-49766072 GCACCTGAGGCAGGGTTGGGAGG No data
1185244540_1185244547 0 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244547 22:49766042-49766064 TAGCAGCTGCACCTGAGGCAGGG No data
1185244540_1185244544 -5 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244544 22:49766037-49766059 GCCTGTAGCAGCTGCACCTGAGG No data
1185244540_1185244553 22 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244553 22:49766064-49766086 GTTGGGAGGAAATGGCCACCCGG No data
1185244540_1185244552 14 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244552 22:49766056-49766078 GAGGCAGGGTTGGGAGGAAATGG No data
1185244540_1185244546 -1 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244546 22:49766041-49766063 GTAGCAGCTGCACCTGAGGCAGG No data
1185244540_1185244548 4 Left 1185244540 22:49766019-49766041 CCGCCCCACTGCAGGTGGGCCTG No data
Right 1185244548 22:49766046-49766068 AGCTGCACCTGAGGCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185244540 Original CRISPR CAGGCCCACCTGCAGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr