ID: 1185247212

View in Genome Browser
Species Human (GRCh38)
Location 22:49779560-49779582
Sequence GGGGGTGTCATACTCATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185247205_1185247212 12 Left 1185247205 22:49779525-49779547 CCTCGGTCATTTTAAGGCAGGAA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1185247212 22:49779560-49779582 GGGGGTGTCATACTCATTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185247212 Original CRISPR GGGGGTGTCATACTCATTTC TGG Intronic
900504582 1:3022934-3022956 GGGGGCGGCAGAGTCATTTCTGG + Intergenic
903949315 1:26986210-26986232 GGTGGTGTCTTCCTCATTACCGG - Intergenic
906537107 1:46557158-46557180 GGCTGTTTCTTACTCATTTCTGG + Intergenic
923496939 1:234533916-234533938 GGGGGTGTTTTTCTCATTTTTGG + Intergenic
1064600575 10:16988121-16988143 GGTTGTGTCATACCCATTACGGG - Intronic
1066755896 10:38712996-38713018 GGGAGTGTCATTATCATTCCTGG + Intergenic
1068698461 10:59994781-59994803 GTGTGTGTCTCACTCATTTCTGG + Intergenic
1069836122 10:71309245-71309267 GGGCTTGTCATCCTCATTGCTGG - Intergenic
1076090540 10:127681718-127681740 AGGGGTGCCATATTCATTTGTGG - Intergenic
1077613760 11:3660733-3660755 GTGGGACTCCTACTCATTTCTGG - Intronic
1082824732 11:57569155-57569177 CGGAGTGTCCTATTCATTTCGGG - Intergenic
1091085295 11:132715799-132715821 GGGGGTGTCTCAGTCAATTCAGG - Intronic
1092829218 12:12427616-12427638 GGGGGTATCATAGTCAATTTGGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1106078925 13:26484565-26484587 GGGGGTGTCATGATGAATTCTGG + Intergenic
1111619799 13:90709847-90709869 GAATGTATCATACTCATTTCTGG - Intergenic
1112434523 13:99382543-99382565 CGTGGTGTCACACTCAGTTCTGG + Intronic
1119447279 14:74676640-74676662 GGGATTATCATACTCATCTCGGG + Exonic
1120271279 14:82316697-82316719 TGAGGTGTCCTAATCATTTCAGG - Intergenic
1122702251 14:103597832-103597854 GGGTGAGTCATACTCATCTCGGG + Intronic
1123440160 15:20285050-20285072 GGGAGTGTCATTATCATTCCTGG + Intergenic
1129025073 15:72564026-72564048 GGGGATGTCTTAATCAGTTCAGG + Intronic
1129786085 15:78311087-78311109 GGGGGTGTCAGTCTCAATCCAGG + Intergenic
1132620597 16:866393-866415 GGGGGTGGCCTAGTCATTGCTGG + Intronic
1133524708 16:6593314-6593336 GGTGGTGTTATAATCAGTTCAGG + Intronic
1135232804 16:20725587-20725609 GGGGCTGTCATATGCATTACAGG + Intronic
1136726783 16:32363874-32363896 GGGAGTGTCATTATCATTCCTGG - Intergenic
1136845011 16:33569386-33569408 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1140231113 16:73118008-73118030 GGGGGTGTCTTAGTTAGTTCAGG - Intergenic
1202999651 16_KI270728v1_random:153884-153906 GGGAGTGTCATTATCATTCCTGG + Intergenic
1203106719 16_KI270728v1_random:1418039-1418061 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1203131249 16_KI270728v1_random:1690284-1690306 GGGAGTGTCATTATCATTCCTGG + Intergenic
1203155179 16_KI270728v1_random:1869684-1869706 GGGAGTGTCATTGTCATTCCTGG - Intergenic
1143782318 17:9235502-9235524 GGGTGTGTCTTAGTCAGTTCTGG + Intronic
1144721101 17:17470457-17470479 AGGGGTCACATACTCACTTCTGG - Intergenic
1150668324 17:67166499-67166521 GTGGGAGTCATACTGATGTCTGG + Exonic
1152118117 17:78401204-78401226 GGGGGTGACAAACTCAGGTCAGG + Intronic
1152655071 17:81515409-81515431 GGGTGTGTCCTTCACATTTCAGG + Intronic
1159868993 18:73739591-73739613 GGGGGGGACATCCTCATTTAAGG - Intergenic
1160803082 19:979543-979565 GGGTTTGGCAGACTCATTTCTGG - Intergenic
1167706549 19:51084489-51084511 GGGGGTTCCATCCTCATTTGGGG + Intergenic
928869696 2:35961744-35961766 GGGTGTGACATTCTCATTTAGGG + Intergenic
929139698 2:38656085-38656107 GGGGGTGTCAGATACACTTCAGG - Intergenic
930953665 2:57176764-57176786 GGGGGTGTCATATACATTGTAGG + Intergenic
931081519 2:58777452-58777474 GGGGCTGTCTTACTCATTGTAGG + Intergenic
933762307 2:85680757-85680779 AGGGGAGACATTCTCATTTCAGG + Intergenic
934319199 2:91957235-91957257 GGGAGTGTCATTATCATTCCTGG + Intergenic
941591182 2:167422432-167422454 GGGGTTGTCTTACTCAGCTCAGG - Intergenic
942369880 2:175272200-175272222 GGGGGCATCATAATCTTTTCAGG - Intergenic
942603685 2:177667728-177667750 GATGGTGTCTTACTCATTGCTGG + Intronic
946878199 2:224151173-224151195 GGGGGTGTCATAGTCCGTTTGGG - Intergenic
947270732 2:228331630-228331652 TGGGGTGTGATACGCTTTTCAGG + Intergenic
1174604017 20:51747405-51747427 GGGGGTGCCTTTGTCATTTCCGG - Intronic
1175519839 20:59594223-59594245 GGGGGTGACTTGCTCATTGCTGG + Intronic
1179412258 21:41170916-41170938 GGGGGTCTTATACGCATTTGGGG + Intronic
1180307378 22:11140881-11140903 GGGAGTGTCATTATCATTCCTGG + Intergenic
1180545898 22:16503104-16503126 GGGAGTGTCATTATCATTCCTGG + Intergenic
1181486621 22:23235643-23235665 AGGGGTGTCTTAGTCACTTCAGG + Intronic
1182213275 22:28694296-28694318 GGGAGTGTCATTATCATTCCTGG - Intronic
1184035573 22:41916279-41916301 GGGGCTGACAGACTAATTTCAGG + Intergenic
1184236147 22:43184106-43184128 GGGGGTGTCATCCACCTTTCAGG + Intronic
1185247212 22:49779560-49779582 GGGGGTGTCATACTCATTTCTGG + Intronic
950744941 3:15080375-15080397 GTGGGTCTCATGCTCATGTCTGG - Intronic
951972689 3:28464807-28464829 GGGGGAGTAAAACTAATTTCAGG + Intronic
954352191 3:50053963-50053985 GGGGATCTCATAGTCAGTTCAGG + Intronic
955206585 3:56901065-56901087 GAGAGTCTCATACTTATTTCTGG - Intronic
956873489 3:73440661-73440683 GGTGTTGTCATAGGCATTTCAGG - Intronic
957983283 3:87539558-87539580 GGGAGTGAGAGACTCATTTCAGG - Intergenic
963797980 3:149650093-149650115 GGAGGTGTACTACCCATTTCTGG + Intronic
965125114 3:164617588-164617610 GGAGGTGACATACTCCTTTATGG - Intergenic
968148832 3:196321291-196321313 GGGGTTCTCAAACTCGTTTCTGG + Intronic
968771390 4:2509792-2509814 GGGAGTGTCATACCCTTTCCAGG + Intronic
969584204 4:8082674-8082696 GGGGGCCTCTTACTCATTTCAGG + Intronic
969847649 4:9931898-9931920 GAGAGAGTCATTCTCATTTCAGG - Intronic
972474979 4:39441588-39441610 CTGGGTTTCATACTCATCTCTGG + Intronic
978255509 4:106687927-106687949 TTGGGTGTTATTCTCATTTCTGG + Intergenic
979611396 4:122692538-122692560 GGGGGTGTCATAGTCAGCTTTGG + Intergenic
980532372 4:134072120-134072142 GGTTGTTTTATACTCATTTCAGG - Intergenic
981843682 4:149141896-149141918 GGGTGATTGATACTCATTTCTGG - Intergenic
982538628 4:156639446-156639468 GGGTGAGTCATACTCATATCTGG + Intronic
986042466 5:4006703-4006725 GGGGGTTTCATCCTGATTTGTGG - Intergenic
987079075 5:14410128-14410150 GCGGGTGTCTTACTCCGTTCTGG + Intronic
990333901 5:54753699-54753721 GGGGGTCTTATCCTCAGTTCTGG - Intergenic
990458972 5:56014874-56014896 GGGGGTGTCAGCCCCATGTCCGG - Intergenic
998875105 5:146591150-146591172 GGGGGGCTCCTACTCATTTCTGG + Intronic
1000026071 5:157360349-157360371 TGGGGAGCCATACTCATGTCGGG - Exonic
1000437967 5:161236685-161236707 GGTTGTGTCATAGTCATTTTAGG - Intergenic
1000513185 5:162208678-162208700 GGGGGTGTCATCTTTATTCCAGG - Intergenic
1002682395 5:180976988-180977010 GGGGGTGGCAGACAGATTTCTGG + Intergenic
1003606546 6:7566620-7566642 GGGGTTGGCAAACTCTTTTCAGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1008113419 6:47518863-47518885 GGGGAATTCATACTCTTTTCAGG - Intronic
1008125827 6:47667077-47667099 GGGATTGTGATTCTCATTTCTGG - Intronic
1010835303 6:80579779-80579801 GCAGGCTTCATACTCATTTCAGG + Intergenic
1013098004 6:106963411-106963433 AGCTGTGTCATATTCATTTCTGG - Intergenic
1013174340 6:107664326-107664348 GGCAGTGTGATCCTCATTTCTGG + Intergenic
1015955898 6:138597827-138597849 GGCTATGTGATACTCATTTCAGG + Intronic
1018344671 6:162888199-162888221 CGGGGTGTCATCCTCATCTGTGG + Intronic
1019958655 7:4437574-4437596 GTGGGTGTCAGACTCCTTCCTGG - Intergenic
1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG + Intronic
1023270885 7:38461290-38461312 GGTGTTGTCACACTGATTTCTGG + Exonic
1024521362 7:50307073-50307095 GGGCCTTTAATACTCATTTCAGG - Intronic
1024970434 7:55064659-55064681 GGGGCTGTCATAATCCTTTGTGG - Intronic
1028672251 7:93415636-93415658 GGGGGTTTCATACGTATTTTAGG - Intergenic
1030288032 7:107846821-107846843 TTGGGTGTCATTCTCATTTTTGG - Intergenic
1033306810 7:140231149-140231171 GGGGGAGTGATGCTCAGTTCTGG + Intergenic
1036409675 8:8487828-8487850 GTGTGTGTCTTAGTCATTTCAGG + Intergenic
1048489566 8:134880169-134880191 GTGGGAGTCATACTGGTTTCTGG + Intergenic
1050327479 9:4511148-4511170 GAGGGTGTCATAGTCTGTTCTGG + Intronic
1050416917 9:5427990-5428012 GGCTGTGTCATACTCCCTTCTGG + Intronic
1052262623 9:26535441-26535463 GGCAGTCTCATTCTCATTTCTGG - Intergenic
1057800491 9:98188176-98188198 GGGTGAGTCAGGCTCATTTCTGG - Intronic
1188355547 X:29186359-29186381 CAAGGTGTCAAACTCATTTCTGG - Intronic
1191940399 X:66474003-66474025 GAGTGTGTCAAACTGATTTCTGG + Intergenic
1192615561 X:72617969-72617991 GGGGGTTTTATAATCATTACAGG - Intronic
1199588773 X:149445638-149445660 GGGTGTGTTATCCTTATTTCTGG - Intergenic
1200881265 Y:8214109-8214131 GGGAGTTTCATTCTCCTTTCAGG + Intergenic
1201186735 Y:11412348-11412370 GGGAGTGTCATTATCATTCCTGG + Intergenic