ID: 1185247528

View in Genome Browser
Species Human (GRCh38)
Location 22:49781090-49781112
Sequence CCATCAACACAGGAGCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185247522_1185247528 -4 Left 1185247522 22:49781071-49781093 CCAGGAAAGAGCCGCTGCCCCAT 0: 1
1: 0
2: 2
3: 11
4: 126
Right 1185247528 22:49781090-49781112 CCATCAACACAGGAGCTGCACGG 0: 1
1: 0
2: 2
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185247528 Original CRISPR CCATCAACACAGGAGCTGCA CGG Intronic
900630520 1:3632746-3632768 CCATCATCACAGCAGAAGCAGGG + Intronic
900760531 1:4467346-4467368 CCACCCACAGAGGGGCTGCAGGG + Intergenic
902267444 1:15277814-15277836 CCATCAAAAAAGAAACTGCAAGG - Intronic
902348138 1:15834530-15834552 CCAGCAGCACAGGAGCTCTAAGG + Intergenic
902560431 1:17273937-17273959 TCATCATCACAGTACCTGCATGG + Intronic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
905205167 1:36339285-36339307 CCAGCACCACAGCAGCTGAAGGG - Intergenic
906202808 1:43970958-43970980 ACATCCACGCAGCAGCTGCAGGG - Exonic
907275772 1:53315902-53315924 ACATCAGCACAGGATCTTCAAGG + Intronic
907385939 1:54125360-54125382 CCCTGAACCCAGGAGCTGTAGGG - Intergenic
907854721 1:58291350-58291372 CCTTCAAGACAGGTGCTCCATGG + Intronic
909514127 1:76488325-76488347 CAATCAACACAGAAGGTGAAGGG - Intronic
910107602 1:83648206-83648228 CCATCAACAGATCAGCTGAAGGG - Intergenic
912859083 1:113196990-113197012 CCATCAACAGCAGAGCCGCAAGG - Intergenic
917387624 1:174494228-174494250 ACATCAACACAAAAGCAGCATGG - Intronic
919653949 1:200179910-200179932 CCATCAACTCAGGAAGGGCATGG - Intergenic
921946978 1:220892728-220892750 CCATCACCTCTGGAGCTGCCTGG - Intergenic
922702044 1:227766951-227766973 CCATCAGCCCAGATGCTGCAAGG - Exonic
924789117 1:247227808-247227830 TCACCATCACAGGAGCAGCATGG + Intergenic
1066048240 10:31612953-31612975 CCATCTAGAAAGGAGCTGCCAGG - Intergenic
1066282707 10:33933101-33933123 TCATCAGCCCAGCAGCTGCAGGG + Intergenic
1070853806 10:79589247-79589269 CCAGTATCACAGGAGCTGCCTGG - Intergenic
1073571240 10:104582747-104582769 CCATCCTCACAGCAGGTGCAGGG - Intergenic
1074703596 10:116112662-116112684 CCATCTACAAAGGAGCTGTCAGG + Intronic
1076351392 10:129817045-129817067 CCTTCAACACAGGAGCAGGGTGG - Intergenic
1079324773 11:19482306-19482328 GGCTCAACACAGGAGCAGCAAGG - Intronic
1081331752 11:41809875-41809897 ACATCCACTCAGCAGCTGCATGG - Intergenic
1084443181 11:69187635-69187657 CCCTCAACTCAGGAGCCACAGGG - Intergenic
1084768389 11:71326904-71326926 CCATGAACACTGGAGTTGCATGG - Intergenic
1088576619 11:111278313-111278335 CCAACAACTCAGAAGCAGCATGG - Intronic
1089456291 11:118627825-118627847 CCGCCAAGACAGTAGCTGCAGGG - Exonic
1089811872 11:121138671-121138693 CCATGAAGACAGGAGCAGCAGGG + Intronic
1090368773 11:126230846-126230868 CTATCAAAACAAGAGCTGCTGGG + Intronic
1090647255 11:128776291-128776313 CCACCACCACAGGAAATGCAAGG + Intronic
1092120504 12:6040392-6040414 CCATGAACAGAGATGCTGCAGGG - Intronic
1097707692 12:62884896-62884918 CCCTCAATACTGCAGCTGCAAGG - Intronic
1101012049 12:100460776-100460798 CCATCCACACATGAGGTGAAGGG - Intergenic
1101796936 12:107983610-107983632 AAATCAACACAGCAGCTCCAGGG - Intergenic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1102356516 12:112241371-112241393 CCATCACCTCAAGAGCTGCCAGG - Intronic
1102490435 12:113287079-113287101 CCATCACCTCAGCAGCTGGAGGG - Exonic
1102573414 12:113841308-113841330 CCATGAACCCAAGATCTGCAGGG - Intronic
1106758147 13:32842796-32842818 TCTCCAACACAGCAGCTGCATGG - Intergenic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1112388522 13:98961775-98961797 CCAGCAACAATGGAGCTGTATGG - Intronic
1112633934 13:101194130-101194152 TGATCAACACAGTAGCTGCTTGG + Intronic
1113855840 13:113445051-113445073 CCAGAAACCCAGGTGCTGCAGGG + Intronic
1115532487 14:34340148-34340170 CCATACACACAGCAGCAGCATGG + Intronic
1117817088 14:59609581-59609603 CATTCAACCCAGGAGCTGCTGGG - Intronic
1117852589 14:59990899-59990921 CCATCAACACAAGACCTGCATGG - Intronic
1119045039 14:71311255-71311277 ACACGAACCCAGGAGCTGCAGGG - Intergenic
1119703208 14:76768879-76768901 CCACCAGCACAGTAGCTGTAAGG - Intronic
1121311725 14:92938986-92939008 CCATCAAGACAGGCACTGCAGGG + Exonic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1123695419 15:22875713-22875735 CAAACAACACAGGAGATGGAAGG + Intronic
1126726158 15:51634594-51634616 CCATAGACAGAGGAGCTGCATGG + Intergenic
1129477922 15:75798971-75798993 CCAGCTACACAGGAGGTGGACGG + Intergenic
1129935044 15:79440320-79440342 CCATCAACCCAAAAGATGCAGGG + Intronic
1132305210 15:100807276-100807298 CCATCAACTCAGAAGGGGCAGGG - Intergenic
1133327179 16:4948916-4948938 CCATCAACACAGCGACTCCAGGG - Intronic
1135111030 16:19691055-19691077 TCATCATCACAGCAGCTGCCAGG - Intronic
1136336206 16:29612426-29612448 CCACCAAAACAGGAGCCCCATGG + Intergenic
1138337612 16:56265577-56265599 CCATCAACCCACCAGCTGGAGGG - Intronic
1138427682 16:56947084-56947106 CCACCGACACAGGGGCTACAGGG + Intergenic
1139545144 16:67646502-67646524 CCCTTACCACAGGGGCTGCAGGG - Exonic
1140140443 16:72251703-72251725 GCATGGACACTGGAGCTGCAGGG - Intergenic
1142036926 16:87868209-87868231 CCACCAAAACAGGAGCCCCATGG + Intronic
1143001796 17:3799276-3799298 CCACCCACACCGGAGCTGCGGGG + Intronic
1143740050 17:8945848-8945870 CAAACAAGACAGTAGCTGCATGG - Intronic
1146291153 17:31608243-31608265 CCATCAGCAGAGCAGCAGCATGG + Intergenic
1150635564 17:66910998-66911020 CAAACCACACAAGAGCTGCACGG - Intergenic
1151284060 17:73097057-73097079 CCATCCGCAAAGGAACTGCAAGG + Intergenic
1153524050 18:5978344-5978366 CCATCAAAAAATAAGCTGCATGG - Intronic
1155500436 18:26482122-26482144 CAATCACCACAGGGGCAGCATGG - Intronic
1157239391 18:45995652-45995674 CCTCCAAGACAGCAGCTGCAGGG + Intronic
1157914677 18:51653406-51653428 CCATCAACCACTGAGCTGCATGG - Intergenic
1158679423 18:59553578-59553600 CCTTCAACACAGGAACAGGAAGG - Intronic
1161232468 19:3181194-3181216 CCACCAACACAGCAGCTGTGAGG + Intergenic
1162966018 19:14156469-14156491 CCCTCAGCACTGGAGCTCCATGG + Intronic
1163105863 19:15122790-15122812 CCACAAACACCGGACCTGCAGGG + Exonic
1163234118 19:16021138-16021160 CCAGCGACATAGGAGCGGCAAGG + Intergenic
1164776850 19:30859377-30859399 CCATCTAGAAAGGAGCTGGATGG - Intergenic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
1165521963 19:36321723-36321745 CCATGAACAGAGGAGCTGTGGGG - Intergenic
1165633848 19:37323820-37323842 CCATGAACAGAGGAGCTGTGGGG + Intronic
927476709 2:23419397-23419419 CAGCCATCACAGGAGCTGCAGGG + Intronic
928082490 2:28323335-28323357 GCATCATCAGAGGTGCTGCACGG - Intronic
931503613 2:62899191-62899213 TCATGAACTCAGGAGCTGAAGGG + Intronic
932552936 2:72790394-72790416 CCATCAACACTTCAACTGCAGGG + Intronic
935784817 2:106539125-106539147 TCATCAACACAGCAACTCCATGG - Intergenic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
938182260 2:129193688-129193710 TCAGCAACACAGAAGCTGGAAGG + Intergenic
946337058 2:219044906-219044928 CCTCCAAAACAGTAGCTGCAGGG - Intergenic
946634081 2:221705351-221705373 CCATCCACACAGGCACTGAATGG + Intergenic
948524569 2:238563123-238563145 CAATCAAAACAGGAACTTCATGG - Intergenic
948599757 2:239101527-239101549 CCATGAACGCAGGGGTTGCAGGG - Intronic
948655857 2:239476357-239476379 CCAGCATCAGAGGAGCTGGAAGG + Intergenic
949071657 2:242028604-242028626 CCAAGAAGACAGGAGCAGCACGG + Intergenic
1169904255 20:10585101-10585123 AAAACAACACAGGAGCTTCAGGG - Intronic
1170823523 20:19774048-19774070 CCATAAACACAGTTGCTCCATGG - Intergenic
1171767536 20:29298213-29298235 CCACCAGCACACGTGCTGCACGG + Intergenic
1172598859 20:36169693-36169715 CCATTTAGACAGGAGATGCAGGG - Intronic
1173019015 20:39251686-39251708 CCATCAACAACGGTACTGCAAGG - Intergenic
1178635077 21:34295286-34295308 TCATCTACATAGCAGCTGCATGG + Intergenic
1179247779 21:39648713-39648735 CCTTCAACACAGGAATTGTAAGG - Intronic
1180176739 21:46094199-46094221 CCAACACCACAGGGGCTGCTGGG + Intergenic
1180245573 21:46545381-46545403 CCTTCCACACAGGCGCTGCTGGG + Intronic
1181658553 22:24321985-24322007 CCATCAGCACAGTAACTCCATGG + Exonic
1182526991 22:30926745-30926767 CCCTCAACCCTGTAGCTGCAGGG - Exonic
1183328299 22:37206129-37206151 TCAGGAACACAGGAGCTGCTGGG - Exonic
1183356575 22:37362980-37363002 CCAGGATCACAGCAGCTGCAGGG - Intergenic
1185247528 22:49781090-49781112 CCATCAACACAGGAGCTGCACGG + Intronic
949862456 3:8518608-8518630 CCATAAACATAGGAGAAGCAGGG + Intronic
950483929 3:13261604-13261626 CCGTCATCACATGTGCTGCAAGG + Intergenic
952269471 3:31817450-31817472 CCATCAACTCAGAAGGGGCAGGG + Intronic
952404458 3:32992990-32993012 CCATCAGCACATGGGCTGCAAGG - Intergenic
953126940 3:40099921-40099943 CCATCAACACATGTGCAACAGGG - Intronic
953659990 3:44884882-44884904 CAATCAACACAAAAGCTGAAGGG - Intronic
957386614 3:79503588-79503610 CCTCCAACACAGGAGCTGTGTGG - Intronic
957615127 3:82517177-82517199 CCATCAACCGAGGAGCTGGCTGG - Intergenic
958164005 3:89855618-89855640 AAATCAACACAGGAGCTTCCTGG - Intergenic
959129936 3:102342002-102342024 CCATCAACAAAGAAGTAGCAAGG - Intronic
960118681 3:113924941-113924963 CAATCAACACAGGAGCATCCAGG - Intronic
960593570 3:119388496-119388518 TCCTCCACACAGGAGCTGGAAGG - Intronic
963651265 3:147983503-147983525 GCATTAACAGAGAAGCTGCATGG - Intergenic
965449704 3:168822534-168822556 CCATCTTCAGAGGATCTGCAGGG + Intergenic
965604700 3:170486358-170486380 TCATCCACACAGGTGCTGCAAGG - Exonic
965626875 3:170690533-170690555 CCACCACCACAGGAAGTGCAGGG + Intronic
966925078 3:184639469-184639491 CCAGCAGCCCAGGAGCTGAAGGG + Intronic
968266447 3:197367005-197367027 CCCTCATCACTGGAGCTGCCAGG + Intergenic
968736673 4:2300833-2300855 CCACAACCACAGGGGCTGCAGGG + Intronic
969334719 4:6500934-6500956 ACATCCACACAGGAGAGGCAGGG + Intronic
969670183 4:8585865-8585887 CCACAAACACAGCAGCTGCTGGG - Intronic
971426521 4:26521275-26521297 GCATCAACTCAGAGGCTGCATGG + Intergenic
972775780 4:42239142-42239164 CCATGAGCACCAGAGCTGCAAGG - Intergenic
973683723 4:53347865-53347887 CCAGCAACACTGCAGGTGCAGGG + Intronic
973879865 4:55259261-55259283 CCATCAGTACAGAAGCTGCATGG - Intergenic
974103900 4:57445885-57445907 TGATCAACACAGGAGATGGAGGG + Intergenic
974301127 4:60068050-60068072 ACATCAACAAATGAGCTGCCTGG - Intergenic
975616288 4:76251193-76251215 GAATCAACACAGGAGCTGGAAGG + Intronic
979189180 4:117835293-117835315 CCCTCATCGCAGGACCTGCAAGG - Intergenic
981833318 4:149027212-149027234 ACATCACCAAAGGAGCTGCTTGG - Intergenic
983875809 4:172873378-172873400 CAAACAAGACAGGAGCTACATGG + Intronic
985780437 5:1868123-1868145 CCTTCAACAGAGGAGCTGCCAGG - Intergenic
985833579 5:2253591-2253613 TCATCAAAAGGGGAGCTGCACGG - Intergenic
989353285 5:40513473-40513495 GCATCAACAGAGAAGCTGCTGGG - Intergenic
990987587 5:61655158-61655180 CCATTAACAAAAGAGCTGAAGGG - Intronic
991260215 5:64659282-64659304 CCATGAATACAGGAATTGCAAGG + Intergenic
991639790 5:68740844-68740866 CCCCCAACAAAGGAGCTGCCAGG - Intergenic
992623796 5:78618613-78618635 CCAACAAGACAGGAACTGCATGG + Intronic
994957887 5:106558134-106558156 CCATCATCTCAGGATCTACAAGG + Intergenic
995506012 5:112861341-112861363 TCAACAACCCAGGAGCCGCAGGG - Exonic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997259311 5:132453969-132453991 CCAGCAAGACAGAAGCTGCATGG + Intronic
999340379 5:150765005-150765027 CCCTCACCCCAGGGGCTGCAAGG - Intergenic
999540888 5:152571545-152571567 CCATTAACACAAGAACAGCACGG - Intergenic
1004013493 6:11711242-11711264 CCATAGAAACAGGAGCTGCAAGG + Intergenic
1007615902 6:43179715-43179737 CCAGCTACTCAGGAGCTGAAGGG - Exonic
1008147749 6:47912127-47912149 CCATCATCACAGATGCTGGAGGG - Intronic
1010142590 6:72628174-72628196 CCTTCCACAGAGGAGCTTCAGGG + Intronic
1013690901 6:112641950-112641972 CCATGAAAAAAGGGGCTGCAGGG + Intergenic
1016764092 6:147773137-147773159 CCAGCAACACAGAAGCTGAAGGG - Intergenic
1016948990 6:149562186-149562208 CCACCATCACAGGAGCTAGAGGG - Intergenic
1019597210 7:1863691-1863713 CCCTCCACCCAGGAGCTCCAGGG - Intronic
1020410896 7:7890356-7890378 CCATCAACAGAGGAGTGACATGG - Intronic
1021945080 7:25718547-25718569 CTATCAACACAGTAGCAGCCTGG + Intergenic
1022531117 7:31067500-31067522 CTATCACCACAGCAGCTGGAGGG + Intronic
1022993202 7:35728608-35728630 CTATCAACCCTGGAGCTGGAGGG + Intergenic
1023332737 7:39136344-39136366 CTATAAACACTGGAACTGCAAGG + Intronic
1024289582 7:47792675-47792697 CCAACAACACAGGGGAGGCAAGG - Exonic
1024707709 7:51979233-51979255 CCATCATGACAGGAGCCACAGGG + Intergenic
1029436284 7:100565780-100565802 CCATCAAAGCCGGAGCTCCAGGG + Exonic
1031746454 7:125505192-125505214 CCATAAACAGAGCAGCTCCAAGG + Intergenic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1034460042 7:151193111-151193133 CCCCCACCACAGGGGCTGCAGGG + Intronic
1035176430 7:157055298-157055320 ACAACAACCCAGGAGCTGCTTGG - Intergenic
1035315888 7:157997482-157997504 CCATCCACACTGGCCCTGCAAGG + Intronic
1036391168 8:8325405-8325427 CCCTCTAAACAGGAGCCGCAGGG - Intronic
1036437585 8:8749307-8749329 CCATCCACAGAGGCGCTGCAGGG - Intergenic
1036900003 8:12663263-12663285 CCATAAACACATGCCCTGCAGGG + Intergenic
1036940975 8:13051588-13051610 CCATCCACACAGGATCTCCATGG + Intergenic
1043704503 8:83331420-83331442 TCATTATCACAGGAACTGCATGG + Intergenic
1045485929 8:102631192-102631214 CCATCATTACAGCAGCTGAATGG - Intergenic
1046244816 8:111545361-111545383 CCCTCAAAACAGGAGCTGTCAGG + Intergenic
1046413804 8:113884162-113884184 CAATCAGCACAGTAGCTGTAGGG + Intergenic
1048526373 8:135206538-135206560 TCATTAACACAGGAACAGCAAGG - Intergenic
1048832825 8:138493028-138493050 CCATCCACACCGGAGGTGGAGGG + Intronic
1055256184 9:74373919-74373941 ACATCACCATAGGATCTGCAAGG + Intergenic
1056840827 9:89996886-89996908 CCATGAACACTGGAGGTGAAGGG + Intergenic
1057764065 9:97900417-97900439 CCATTCCCACAGGATCTGCATGG - Intergenic
1058647555 9:107144709-107144731 CTATCAAGACTGTAGCTGCAGGG + Intergenic
1059033535 9:110728132-110728154 GCACCAACACAGAAGCTGCTTGG - Intronic
1061424053 9:130488356-130488378 CCACCCAGACAGCAGCTGCAGGG + Intronic
1062028776 9:134352627-134352649 CCAGCACCCCGGGAGCTGCAGGG - Intronic
1062605974 9:137349030-137349052 CCATAAACCAAGGACCTGCATGG - Intronic
1188872701 X:35393272-35393294 CAATGAAGGCAGGAGCTGCAAGG + Intergenic
1189179112 X:38986774-38986796 CCACCACCAGAGGGGCTGCAGGG - Intergenic
1190856142 X:54296799-54296821 CCATCAGCACTGCAGCTGCCTGG + Intronic
1192726945 X:73763726-73763748 CAGCCAACACAGCAGCTGCAGGG - Intergenic
1192944520 X:75950443-75950465 CCTTCTACATGGGAGCTGCAGGG + Intergenic
1195571511 X:106402637-106402659 CTAGCAGCCCAGGAGCTGCAAGG - Intergenic
1196144364 X:112300773-112300795 CCATAAACACAGTAGGAGCAGGG - Intergenic
1196343076 X:114619645-114619667 CCATCAAAACACGAGCTTAAAGG + Intronic
1199983073 X:152931755-152931777 CCCCCAACACAGATGCTGCAAGG + Exonic
1200266619 X:154649564-154649586 GCAACACCACAGGCGCTGCAGGG - Intergenic