ID: 1185250655

View in Genome Browser
Species Human (GRCh38)
Location 22:49799925-49799947
Sequence GACCCTACCTCAAAGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185250643_1185250655 20 Left 1185250643 22:49799882-49799904 CCTGGCCGCATGAGGCCTGCTCG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250644_1185250655 15 Left 1185250644 22:49799887-49799909 CCGCATGAGGCCTGCTCGTCACA 0: 1
1: 0
2: 1
3: 4
4: 106
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250638_1185250655 28 Left 1185250638 22:49799874-49799896 CCCCCAGGCCTGGCCGCATGAGG 0: 1
1: 0
2: 5
3: 88
4: 671
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250642_1185250655 25 Left 1185250642 22:49799877-49799899 CCAGGCCTGGCCGCATGAGGCCT 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250641_1185250655 26 Left 1185250641 22:49799876-49799898 CCCAGGCCTGGCCGCATGAGGCC 0: 1
1: 0
2: 3
3: 35
4: 217
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250640_1185250655 27 Left 1185250640 22:49799875-49799897 CCCCAGGCCTGGCCGCATGAGGC 0: 1
1: 0
2: 1
3: 28
4: 239
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126
1185250648_1185250655 5 Left 1185250648 22:49799897-49799919 CCTGCTCGTCACAGTGCCGGGGC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185250655 Original CRISPR GACCCTACCTCAAAGGGGAG AGG Intronic
901663452 1:10813260-10813282 GACTCTGTCTCAAAGGGGTGAGG - Intergenic
903213914 1:21832837-21832859 GAGTCTCCCTCAAGGGGGAGAGG + Intronic
903354144 1:22736242-22736264 GACTGTACCTGAAAGGGGATTGG + Intronic
907701204 1:56789799-56789821 GGGCCTACCTCATAGGAGAGAGG + Intronic
908528641 1:65012137-65012159 GACCCCACAGCAAAGTGGAGAGG + Intergenic
908795504 1:67827209-67827231 GACCTTGCCTGCAAGGGGAGTGG + Intronic
910487462 1:87731336-87731358 GTCCCTACCTCATGGGGGTGGGG - Intergenic
912541811 1:110422104-110422126 TACCCTTCCTCATAGGGGAGTGG - Intergenic
912736352 1:112152711-112152733 GACCCTACCACAGTGGGCAGGGG + Intergenic
915215856 1:154340406-154340428 GACGCCACCTCAAAGAGGGGTGG - Intronic
916175558 1:162035362-162035384 GCCTATACCTCAAAGGTGAGTGG + Intergenic
917569956 1:176254937-176254959 TACCCTTCTTCAAAGGGGAAGGG + Intergenic
920227914 1:204451247-204451269 GACCCCATAGCAAAGGGGAGAGG + Intronic
1067071394 10:43135219-43135241 GACCCTATCGCAAAGCGGCGGGG - Intergenic
1067204678 10:44202659-44202681 GACCCTGACTCTCAGGGGAGAGG - Intergenic
1068069972 10:52183415-52183437 GGCCCTTCCCCAAATGGGAGAGG - Intronic
1069484463 10:68812667-68812689 GACACTACCTCAGTGGGGACGGG + Intergenic
1073186538 10:101618573-101618595 GACCCTGGCCCAAAGGGGAAGGG + Intronic
1077446406 11:2593063-2593085 GTCCCCTCCTCATAGGGGAGTGG + Intronic
1081778856 11:45696000-45696022 CTGCCTACCTCACAGGGGAGCGG + Intergenic
1081992659 11:47346181-47346203 AGCCCTTCCTCAGAGGGGAGAGG - Intronic
1083662023 11:64255882-64255904 GCCTCTAGCTCAATGGGGAGAGG + Intronic
1085330292 11:75643751-75643773 GCACCTACCTCATAGGGGTGGGG - Intronic
1086472627 11:87131734-87131756 GAACATACCTCATAGGGGAGGGG + Intronic
1089685366 11:120143311-120143333 TACCCTACCTGGGAGGGGAGGGG + Intronic
1089897617 11:121947542-121947564 CAGCCTACCTTCAAGGGGAGGGG - Intergenic
1091797843 12:3307470-3307492 GACCATCCTTGAAAGGGGAGAGG + Intergenic
1097162597 12:57059026-57059048 GACCCTTCCTGAAAGGGCAAAGG + Exonic
1097877020 12:64653075-64653097 GACCCTATCTCAAAAGAGAAGGG - Intronic
1099295169 12:80821246-80821268 GTCCCTAGCTGAGAGGGGAGAGG - Intronic
1100784519 12:98064944-98064966 TACCTGACCTCAAAGGGGACTGG - Intergenic
1102461738 12:113104134-113104156 GACCCCACCGCGATGGGGAGCGG - Intronic
1102932668 12:116874581-116874603 GACTCCACCTCATGGGGGAGTGG - Intronic
1110798182 13:79664649-79664671 GACCCAACCTCAAGTGGGAGGGG - Intergenic
1113902574 13:113805014-113805036 GGCCCTACCTGAAGGGGCAGAGG - Exonic
1115400158 14:32948873-32948895 GACCCTTCATCTAAAGGGAGCGG + Intronic
1116943345 14:50812256-50812278 GACCCTACCTCAAAATTGAAAGG + Intronic
1117437463 14:55730422-55730444 AACACTACCTCAAAGGGAAAAGG - Intergenic
1118692259 14:68351534-68351556 ACCCTTACCTCAAAGGAGAGGGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1121473606 14:94174765-94174787 GACCCTTCCTCAGAGCGGACCGG + Intronic
1122392429 14:101399385-101399407 AACCCTACCTCAAAGGGGGAGGG + Intergenic
1124691000 15:31822822-31822844 GACTTGACCTCAAAGTGGAGGGG + Intronic
1124973184 15:34510168-34510190 CATCTTGCCTCAAAGGGGAGAGG + Intergenic
1126157211 15:45576799-45576821 CACCCAACATCAAAGGGGTGGGG - Intergenic
1126713109 15:51483544-51483566 TACCCTCCCCCAAATGGGAGAGG + Intronic
1128647004 15:69384934-69384956 GACCCTAGCTCACAGGAGAAGGG - Intronic
1129141766 15:73605087-73605109 GACCCTGTCTCAAGGGGGGGGGG + Intronic
1130427086 15:83812230-83812252 CACCCCACCTCAAGTGGGAGAGG + Intronic
1132866323 16:2094341-2094363 GACCCTACCCCAAACGAGAGTGG + Intronic
1133414699 16:5597300-5597322 GACCCTGTCTCAAAAGAGAGAGG - Intergenic
1133639042 16:7699194-7699216 GACCCTATCTCAAAGAGAAAAGG - Intronic
1133858567 16:9573026-9573048 GCCCTTATCCCAAAGGGGAGAGG + Intergenic
1134291915 16:12908460-12908482 GAGCCTACCTCATGGGGGAAGGG - Intronic
1134409645 16:13993351-13993373 GTCCCTACCTCATAGGGGTTTGG + Intergenic
1135795225 16:25434981-25435003 TACCCTTCTTCATAGGGGAGAGG - Intergenic
1140126159 16:72120540-72120562 GACTCTTCAGCAAAGGGGAGCGG - Intronic
1140419309 16:74804985-74805007 GACCCTATCTCAAAAGGAAAGGG - Intergenic
1143416826 17:6756563-6756585 GACCACACCTCTAACGGGAGGGG + Intronic
1144067664 17:11639153-11639175 GACCCATGCTTAAAGGGGAGAGG + Intronic
1145224136 17:21113866-21113888 AACTCTACCACAATGGGGAGAGG - Intergenic
1145899490 17:28480968-28480990 GACCCAGCCTCAAAGGCCAGGGG + Intronic
1146949726 17:36897535-36897557 GACATTACTTCAAAGGGAAGGGG + Intergenic
1149606578 17:57929243-57929265 GCCCCTGCCTCATAGGGCAGGGG - Intronic
1151988640 17:77559831-77559853 GACCCTTCCTCACAGAGGATGGG - Intergenic
1152663423 17:81553352-81553374 ACCCCAACCTCAAAGGGGGGCGG - Intronic
1163234579 19:16023137-16023159 GATCCAGCCTCACAGGGGAGTGG + Intergenic
1164489127 19:28690572-28690594 GACACCACCCCAATGGGGAGGGG - Intergenic
1164780661 19:30889136-30889158 GTCCCTGCTTCAAAGGGCAGTGG + Intergenic
1168461476 19:56562611-56562633 TAGCCTACCTTCAAGGGGAGGGG + Intergenic
925573254 2:5333871-5333893 AACCCACCCTCAAATGGGAGGGG - Intergenic
926139475 2:10359732-10359754 GCCCCTTCCTCAGAGTGGAGAGG - Intronic
932599080 2:73111967-73111989 TCCCTTTCCTCAAAGGGGAGGGG - Intronic
935341613 2:102064217-102064239 GACCCTCCCTCATAGGGCTGTGG + Intergenic
935763745 2:106344438-106344460 GGGCCTACCTCAAAGGAGTGGGG + Intergenic
936044725 2:109177885-109177907 AATCCTACCTCAAAGGAGAAAGG - Intronic
942406321 2:175660268-175660290 GACACCACCTCACTGGGGAGGGG + Intergenic
946245901 2:218387240-218387262 CACCCCACCTCATAGGGGAGTGG + Intronic
1168841401 20:912284-912306 GACCCCACATCAAAGGTCAGGGG + Intronic
1170978931 20:21192735-21192757 TACCCTTCTTCATAGGGGAGGGG + Intronic
1172511259 20:35502653-35502675 GACCCTAGCTGAAAGAGAAGAGG + Exonic
1173041587 20:39469148-39469170 GACCCTGCTTCAAATGTGAGTGG - Intergenic
1174802026 20:53572403-53572425 GACCCTGTCTCACAGAGGAGGGG + Intronic
1175459017 20:59136935-59136957 GTCCCAACCTTAAAGGGAAGGGG + Intergenic
1179880293 21:44290783-44290805 AACCCTTCCTCACAGGGCAGTGG - Intronic
1179993141 21:44959008-44959030 CTCCCGACCACAAAGGGGAGGGG - Intronic
1183510872 22:38234112-38234134 GACCCCACCTCTCAGAGGAGGGG - Intronic
1183753367 22:39735684-39735706 GTCCCTACCTCAAAGGATTGTGG + Intergenic
1184841033 22:47052516-47052538 GACCCTCCCACAGTGGGGAGGGG + Intronic
1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG + Intronic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
952606391 3:35152196-35152218 GAGCCTACTTAAAAGGGTAGAGG - Intergenic
952868264 3:37873006-37873028 GACACCACCTCAATGGGAAGGGG + Intronic
952871388 3:37904280-37904302 GACCCTTCCTCAAAGGGAACTGG - Intronic
953829158 3:46280603-46280625 GACCCTGTCTCAAAGGGGCGGGG - Intergenic
959557119 3:107733499-107733521 GACCCTGTCTCAAGGGGGGGTGG - Intronic
971328455 4:25663256-25663278 GACTCTACCTCAAAGATGGGAGG - Intronic
973532127 4:51844250-51844272 GACCCTGCCTCGACAGGGAGAGG - Intronic
973710134 4:53621761-53621783 GACCCCACCTCAAATGATAGAGG + Intronic
975028241 4:69578693-69578715 GACCCTATCTCAAATAGTAGAGG - Intergenic
975734896 4:77371579-77371601 CATCCAACCTCAAAGGGAAGGGG - Intronic
978093312 4:104744492-104744514 GACCATAACTCAAAGGCCAGAGG - Intergenic
992787145 5:80181254-80181276 GACCCTGTCTCAAAAAGGAGTGG - Intronic
998441214 5:142163980-142164002 TTCCCTACCTCAAAGGGTTGGGG - Intergenic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1001004809 5:168040764-168040786 GCCTCTTCCTCAAAGAGGAGGGG - Intronic
1001692476 5:173643382-173643404 GACCTGACCTCTAAGGTGAGAGG + Intergenic
1002060837 5:176625034-176625056 GACCCTGCCTCCATGGGGATGGG - Intronic
1002133671 5:177095882-177095904 CACCCTTCCCCAGAGGGGAGAGG + Intronic
1002812027 6:639916-639938 GACCCTTCTTCAAAGGGAAAGGG + Intronic
1005967347 6:30736241-30736263 GACCCGGTCTCAAAGAGGAGAGG + Intronic
1006535628 6:34696708-34696730 GGGCCTACCTCAAAGGAGCGGGG - Exonic
1006910358 6:37559424-37559446 GACCCTAGGAGAAAGGGGAGAGG - Intergenic
1007096974 6:39219278-39219300 GTCCCTCCCTCAAAGGGGAGAGG + Intronic
1008788925 6:55204792-55204814 GACCCTATCTCCAAAGGGAAGGG - Intronic
1009629350 6:66173667-66173689 GACCCCACCTCAGAGGAGAATGG + Intergenic
1016821293 6:148348882-148348904 TACCCAACCTCACAGGGCAGTGG + Intronic
1018055793 6:160051169-160051191 TACCCTATTTCACAGGGGAGAGG + Intronic
1018950779 6:168377501-168377523 GACCCCACCTCCAAGGCCAGGGG - Intergenic
1020420918 7:8003983-8004005 GACCTTACCTCACAGGACAGTGG + Exonic
1021317852 7:19172107-19172129 GACCCTATCTACAAGGGAAGTGG - Intergenic
1022433260 7:30349499-30349521 GTACCTACCTCACAGGGTAGTGG - Intronic
1023157273 7:37263649-37263671 GACCCCACCACATTGGGGAGTGG + Intronic
1030672400 7:112351951-112351973 AGCCCTACCTCCAGGGGGAGGGG + Intergenic
1040455334 8:47592453-47592475 GTCCCTCCCTCAAAGGGGGAAGG + Intronic
1040551562 8:48441937-48441959 GAAGCTCCTTCAAAGGGGAGTGG + Intergenic
1048288130 8:133158395-133158417 CACCCTCCATCCAAGGGGAGTGG - Intergenic
1050198519 9:3114204-3114226 CACCCTACTTCCACGGGGAGTGG + Intergenic
1050434339 9:5593110-5593132 CACCCCAACTCTAAGGGGAGTGG + Intergenic
1057484019 9:95468074-95468096 GACCCTGTCTCAAAAGAGAGGGG - Intronic
1057974799 9:99593909-99593931 CACCCTACCTCAGAGGGGAGGGG - Intergenic
1060417001 9:123437781-123437803 GTCCCTTCCTCAAAGGGATGTGG + Intronic
1061058756 9:128239847-128239869 GACCCTTCCCCTCAGGGGAGGGG - Intronic
1062092179 9:134684100-134684122 GGCCCCACTTCCAAGGGGAGGGG + Intronic
1185815242 X:3148836-3148858 GACCATATCTAGAAGGGGAGAGG + Intergenic
1186814003 X:13217489-13217511 GTGCCTACATCAAGGGGGAGAGG + Intergenic
1196031515 X:111098665-111098687 GACGGTGCCTCAAAGGGAAGTGG + Intronic