ID: 1185253349

View in Genome Browser
Species Human (GRCh38)
Location 22:49817217-49817239
Sequence GGTCAAGGAGTCACCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185253340_1185253349 25 Left 1185253340 22:49817169-49817191 CCAGGAATGGCTCAGAAGGGGTG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1185253349 22:49817217-49817239 GGTCAAGGAGTCACCCCTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 141
1185253346_1185253349 -3 Left 1185253346 22:49817197-49817219 CCAGTGGTGATGGCACGGTGGGT 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1185253349 22:49817217-49817239 GGTCAAGGAGTCACCCCTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185253349 Original CRISPR GGTCAAGGAGTCACCCCTGG AGG Intronic
900031359 1:375263-375285 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900051911 1:603463-603485 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900721005 1:4175791-4175813 GGACAAGGAGGCAGCACTGGTGG - Intergenic
900739661 1:4323004-4323026 GGGAACGAAGTCACCCCTGGAGG - Intergenic
901817909 1:11805562-11805584 GGTCACTGAGTCACCGATGGGGG + Intronic
902238749 1:15074437-15074459 GGTGAAGGAGTCACTCCTCATGG + Intronic
902636500 1:17738249-17738271 GTCCAAGAAGTCACCTCTGGTGG + Intergenic
906341549 1:44985339-44985361 GGAAAAGGAGTCACTTCTGGAGG - Intronic
910180469 1:84477518-84477540 GATCAAGGACTGAACCCTGGAGG - Intergenic
918398864 1:184143985-184144007 GGTCAAGAAGGCTCTCCTGGGGG - Intergenic
919877325 1:201879412-201879434 GGCCAAGGACACAGCCCTGGGGG - Exonic
924363977 1:243269746-243269768 GGTAAAGGAGTCAGGCATGGTGG + Intronic
1062852884 10:759307-759329 GGTCAAGGGGGCTCTCCTGGCGG - Intergenic
1067246336 10:44549649-44549671 GGTCAAGGTGTCACCTGTAGAGG - Intergenic
1069818418 10:71212935-71212957 GGCCAGGGAGACAGCCCTGGGGG + Exonic
1071876873 10:89851987-89852009 GATCAAGGACTCTCTCCTGGTGG + Intergenic
1076313595 10:129525523-129525545 GGTCAAAGAATGAGCCCTGGTGG - Intronic
1076670838 10:132120367-132120389 GCTCCAGCAGCCACCCCTGGGGG - Intronic
1077419195 11:2441640-2441662 GGCCCAGGAGACAGCCCTGGGGG + Intergenic
1077695084 11:4386242-4386264 GTTCCAGGACTCACTCCTGGGGG + Exonic
1079394360 11:20049129-20049151 AGTCAAGGAGTCGTCCTTGGAGG - Exonic
1081526520 11:43931474-43931496 GGTCCAGGGGTCACCACTGTGGG + Intronic
1082023475 11:47553482-47553504 GGGCAAGGAGGCACCCCTACTGG + Intronic
1083881658 11:65551910-65551932 GGTCAAGGGGTCAGGCCTAGGGG + Intronic
1084344166 11:68533199-68533221 GGTAAATTAGTCACCCCTGCTGG - Intronic
1087304404 11:96472265-96472287 GGTAAATGAGTGACCCCTAGTGG + Intronic
1089054799 11:115576919-115576941 GATTCAGGATTCACCCCTGGAGG + Intergenic
1089195771 11:116693291-116693313 GGCCAAGGGGGCAGCCCTGGAGG + Intergenic
1090428369 11:126626152-126626174 GGTCTAGGAGGGACCCTTGGGGG + Intronic
1090648494 11:128786091-128786113 TGCCCAGGAGTCACCCTTGGAGG - Intronic
1094600086 12:31901094-31901116 GGACAAGGAGTCACAACTGCAGG - Intergenic
1100838980 12:98593380-98593402 GGTCAAGGAGAGACACCTGAAGG + Intergenic
1103393524 12:120591004-120591026 GGTCAGGGAGGGACCACTGGGGG - Intergenic
1103568612 12:121829891-121829913 AGGCAAGGGGTCACCCCTGGGGG + Intronic
1104849429 12:131864265-131864287 GGAGGAGGAGCCACCCCTGGGGG - Intergenic
1106139607 13:27001224-27001246 GGTCAAGGTGTCAGCAGTGGTGG - Intergenic
1111921509 13:94416569-94416591 GGTCAAGGAGGCAGTCCTGCAGG - Intergenic
1112429820 13:99341610-99341632 GGTGATGGAGTCACCTCTGTAGG + Intronic
1113425044 13:110200838-110200860 AGTTAAGGAGTCTCACCTGGAGG + Exonic
1118320532 14:64749718-64749740 TGTCATGGAGACACCTCTGGAGG + Exonic
1122194352 14:100073985-100074007 GTTCAGGGAGTCACCCCCGGGGG + Intronic
1122720222 14:103717648-103717670 AGTCAAGGTGGCACCCCTCGTGG + Intronic
1125335609 15:38623284-38623306 GGTCAAGGAATACCCCGTGGAGG - Intergenic
1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG + Intronic
1129207859 15:74047911-74047933 GATCAAGGGGTCAACCATGGAGG + Intergenic
1129869879 15:78933351-78933373 GGTCAGGCAGTCACCCCCGTGGG + Intronic
1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG + Intergenic
1132429996 15:101752516-101752538 GAACAAGGAGACACTCCTGGAGG + Intergenic
1132431360 15:101764768-101764790 GGACAAGAAGACACTCCTGGAGG + Intergenic
1132744240 16:1430133-1430155 AGGCAAGGAGCCACTCCTGGAGG + Intergenic
1133050268 16:3113466-3113488 GGACAAGGAGACACCCCCGGAGG + Exonic
1135789381 16:25379599-25379621 GGTCAAGGGGTTGCCTCTGGTGG + Intergenic
1135880324 16:26249221-26249243 GGGCAAGGAGACACCCAGGGAGG + Intergenic
1137444128 16:48521754-48521776 GGTCTCAGAGTCACCCATGGTGG - Intergenic
1142241401 16:88948507-88948529 GGTCAAGGAGACCCTCCCGGAGG + Intronic
1142400267 16:89854894-89854916 GGTCCAGGAATGGCCCCTGGAGG + Intronic
1142496882 17:310651-310673 GGTTAAGGCGGCAGCCCTGGGGG - Intronic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146921134 17:36712870-36712892 GGACAAGGACTCACCCTAGGTGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151679774 17:75617115-75617137 GGTCGAGGAGCCACAGCTGGCGG - Intergenic
1152032997 17:77855216-77855238 GGACAGGGAGGAACCCCTGGAGG - Intergenic
1152209820 17:78997145-78997167 GGTCCTGGAGTCCCACCTGGCGG - Exonic
1152948294 17:83210450-83210472 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1155266560 18:24100325-24100347 GGTTTAGGGCTCACCCCTGGAGG + Intronic
1157290802 18:46408154-46408176 GGTTGAGGAGTCTGCCCTGGAGG + Intronic
1158547915 18:58411522-58411544 GGGAAAGGAGGCAGCCCTGGAGG + Intergenic
1160129426 18:76211398-76211420 GGTGGAGGAGTCTCCCCTCGGGG - Intergenic
1163404682 19:17114729-17114751 TTTCAAGAAGTCACCCCAGGAGG - Intronic
1165622942 19:37263769-37263791 GGTCTAGAAGTCAATCCTGGAGG - Intergenic
1167380531 19:49135655-49135677 GGTCAAGGGGCCAGGCCTGGTGG - Intronic
926795022 2:16611979-16612001 GGGCAAGGAGTCCCCCCTGCAGG - Intronic
929431848 2:41893786-41893808 GGTTGAGGAGTCCCCTCTGGAGG - Intergenic
929592074 2:43153932-43153954 GGTCAGGGAGTCCTCCCTGGAGG + Intergenic
932567876 2:72920871-72920893 GGTCTAGGAGCAACGCCTGGAGG + Intronic
935727545 2:106037091-106037113 GGTCCAGGAGCCACGCTTGGAGG - Intergenic
940838356 2:158550519-158550541 CATCAGGGAGTCAGCCCTGGTGG - Intronic
944022398 2:195122589-195122611 GGTCACGGAGACACCCATAGAGG - Intergenic
1172499070 20:35412181-35412203 GGTCAAGGAGACAGGCGTGGGGG - Intergenic
1174563558 20:51448271-51448293 GGTCAAGGAGGACCCCGTGGAGG + Intronic
1175424522 20:58855170-58855192 GGTCAAGAAGGTACCCCTGGCGG + Exonic
1179768056 21:43588849-43588871 GGTCAAGTATCCAACCCTGGTGG + Intronic
1181107678 22:20584620-20584642 GGTGAAGGAGGCACCCACGGGGG - Intronic
1181627439 22:24131363-24131385 GGTCATGAAGTCACAGCTGGAGG + Intronic
1182308599 22:29388615-29388637 GGTCAAGGGTACAACCCTGGCGG + Intronic
1183664048 22:39237229-39237251 GGTCATGGATGAACCCCTGGAGG - Intronic
1184115348 22:42418798-42418820 GGTCAGGGAAAGACCCCTGGGGG - Intronic
1184862163 22:47178557-47178579 GGTCACGCAGCCAGCCCTGGTGG - Intergenic
1185253349 22:49817217-49817239 GGTCAAGGAGTCACCCCTGGAGG + Intronic
952451518 3:33438453-33438475 AGTCATGGAGTCACCCCAGAGGG - Intronic
954744948 3:52782515-52782537 GGTCATGGAGTTACCCCCTGGGG + Intronic
955227670 3:57074356-57074378 TGGCTACGAGTCACCCCTGGTGG - Exonic
957822948 3:85401517-85401539 GGTCACTGTGTCACCCCTAGAGG + Intronic
959627291 3:108466783-108466805 GTTCAAGGTGTCCCCCCTGCAGG + Intronic
969216960 4:5730685-5730707 GGTCCAGGATCCACGCCTGGAGG + Intronic
970533626 4:17007013-17007035 TGTCAAGGAGGCACCCTGGGAGG - Intergenic
970609065 4:17708987-17709009 GGTCCAGGAGTCAGCCCTGCAGG - Exonic
971453737 4:26823933-26823955 GGTCAGGCAGTCAGCCCGGGTGG - Intergenic
972715409 4:41641113-41641135 AGTCCAGGAGTCTCCCTTGGTGG - Intronic
981812909 4:148795675-148795697 GGTCAAGTAGTCTTCCCTGAAGG - Intergenic
985940004 5:3127740-3127762 GGGCAAGGAGTCCTCCCTGGGGG - Intergenic
986091959 5:4517582-4517604 GGAGAAGGAGTCACTCCTGCCGG - Intergenic
992463512 5:76984494-76984516 GGACAAGGCGTCTCGCCTGGCGG + Intergenic
995861990 5:116650756-116650778 GGTCATGGCGTCAGCCTTGGAGG + Intergenic
998929902 5:147170017-147170039 GGACAAGGTGTCACACCTGATGG + Intergenic
1001888600 5:175319186-175319208 GGTCAAGGGGTCACAACTGGTGG - Intergenic
1002484171 5:179523499-179523521 GGTGAAGCTGTCACCTCTGGGGG - Intergenic
1002742461 5:181443605-181443627 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1003217231 6:4125488-4125510 GGACAAGGAGGCACTGCTGGTGG - Intronic
1005693779 6:28332803-28332825 GTTCAGGGGGACACCCCTGGTGG - Intronic
1007132127 6:39485010-39485032 GGCCAAGGAGAGAGCCCTGGGGG - Intronic
1013808894 6:114022306-114022328 TGCCAAGGAGTCTCGCCTGGGGG + Intergenic
1013980111 6:116120545-116120567 GGTCAAGCAGTCATGCCTGAGGG - Exonic
1014867986 6:126555528-126555550 GCTCCAGGAGTCAGCCCTCGGGG - Intergenic
1019247597 6:170719344-170719366 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1019470827 7:1219702-1219724 GGGCCTGGAGACACCCCTGGTGG + Intergenic
1021252787 7:18352487-18352509 TGCCAGGGAGTCACCTCTGGAGG + Intronic
1028626179 7:92880378-92880400 GGTAAATGAGTGACCCCTAGTGG + Intergenic
1029580709 7:101435342-101435364 GGCCATGTAGTCGCCCCTGGAGG + Intronic
1032200895 7:129822050-129822072 GGCCAAGGTGTGACACCTGGAGG - Intergenic
1035500540 8:88592-88614 GGCCCAGGACTGACCCCTGGAGG - Intergenic
1037199155 8:16229546-16229568 GGTCAAAAAGCCACACCTGGTGG - Intronic
1039451915 8:37681911-37681933 TGTCAGGGATTCAGCCCTGGGGG - Intergenic
1043811737 8:84750816-84750838 GGTCAAGGGGCCACATCTGGTGG - Intronic
1045492750 8:102682712-102682734 AGTAAAGGAGTCCCCACTGGGGG - Intergenic
1047677429 8:127218576-127218598 GGTCAAGGAGGGCCGCCTGGAGG - Intergenic
1049241671 8:141540485-141540507 GATCAAGGTGTCCCTCCTGGGGG + Intergenic
1049457869 8:142702996-142703018 GGTCAAAGCCTCACCCCTGGCGG - Intronic
1049979627 9:892323-892345 GATCCAAGAGTCACCACTGGAGG - Intronic
1051704349 9:19860714-19860736 GGTCTAGGACTCACCCATCGGGG - Intergenic
1057129280 9:92641981-92642003 GGCCAAGGACTCTCTCCTGGGGG + Intronic
1060743728 9:126116440-126116462 GGTCAAGGAGTCAGCTCTTGGGG + Intergenic
1061425623 9:130496670-130496692 GGCCAAGGAGGAGCCCCTGGAGG + Intronic
1061793553 9:133071217-133071239 GGTCTCGGAGTCACCCGTGGGGG - Exonic
1061793737 9:133071613-133071635 GGTCTCGGAGTCACCCGTGGGGG - Exonic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062438066 9:136555695-136555717 GGTGTAGGTGTCAGCCCTGGGGG - Intergenic
1187735961 X:22303863-22303885 GGTCAAGGATTTTCCCATGGGGG - Intergenic
1191616678 X:63176907-63176929 GGGCAAGGAGGCACCTCTGTCGG - Intergenic
1191619619 X:63202016-63202038 GGGCAAGGAGGCACCTCTGTCGG + Intergenic
1192875220 X:75222709-75222731 GGTCTAGGATTCACCCTTTGGGG + Intergenic
1202058155 Y:20857501-20857523 GGTCAAGGACTCACTTGTGGAGG + Intergenic