ID: 1185255109

View in Genome Browser
Species Human (GRCh38)
Location 22:49827497-49827519
Sequence CTTCGGGGCGCCGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 254}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185255101_1185255109 -9 Left 1185255101 22:49827483-49827505 CCCCGCCCACTCACCTTCGGGGC 0: 1
1: 0
2: 1
3: 19
4: 124
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255094_1185255109 2 Left 1185255094 22:49827472-49827494 CCCGGCCAGGCCCCCGCCCACTC 0: 1
1: 0
2: 6
3: 80
4: 761
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255092_1185255109 6 Left 1185255092 22:49827468-49827490 CCTCCCCGGCCAGGCCCCCGCCC 0: 1
1: 1
2: 27
3: 251
4: 1808
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255088_1185255109 26 Left 1185255088 22:49827448-49827470 CCCGCGAGGCGGCGGGGAGGCCT 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255099_1185255109 -8 Left 1185255099 22:49827482-49827504 CCCCCGCCCACTCACCTTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255096_1185255109 -3 Left 1185255096 22:49827477-49827499 CCAGGCCCCCGCCCACTCACCTT 0: 1
1: 0
2: 6
3: 52
4: 529
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255102_1185255109 -10 Left 1185255102 22:49827484-49827506 CCCGCCCACTCACCTTCGGGGCG 0: 1
1: 0
2: 2
3: 7
4: 92
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255095_1185255109 1 Left 1185255095 22:49827473-49827495 CCGGCCAGGCCCCCGCCCACTCA 0: 1
1: 1
2: 5
3: 131
4: 1000
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255093_1185255109 3 Left 1185255093 22:49827471-49827493 CCCCGGCCAGGCCCCCGCCCACT 0: 1
1: 0
2: 4
3: 73
4: 577
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254
1185255089_1185255109 25 Left 1185255089 22:49827449-49827471 CCGCGAGGCGGCGGGGAGGCCTC No data
Right 1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185255109 Original CRISPR CTTCGGGGCGCCGCGGCCGC GGG Intronic
900166748 1:1247007-1247029 CGTCGGGGCGCCCGGGCGGCTGG - Intergenic
901082880 1:6593376-6593398 CATCGGGGTCCCGCGGCGGCCGG + Exonic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
902600903 1:17539730-17539752 CCTCGGAGCGCGGCGGGCGCGGG + Intergenic
903468485 1:23568497-23568519 CGTGGGGACGCCGGGGCCGCAGG - Intergenic
903883720 1:26529630-26529652 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
903907432 1:26696589-26696611 CGTGGGGCCGCCGCAGCCGCTGG + Exonic
903950719 1:26994442-26994464 CTGCGGGGAGGCGGGGCCGCGGG - Exonic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
906650359 1:47508451-47508473 CCTGGGGCCGCCGCGGCCGCAGG + Intergenic
908534633 1:65066695-65066717 CTCCGGACCGCCGCCGCCGCGGG + Intergenic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
911440512 1:97920786-97920808 CTCCGGGGTGCGGGGGCCGCGGG + Intronic
915934818 1:160084278-160084300 CTCCAGGTCGCCGCGGCCGTAGG - Exonic
916233350 1:162561663-162561685 ATCCGGGGGGCCGCGGCGGCGGG - Exonic
917028235 1:170664430-170664452 CTGCGGGGTGTCGCTGCCGCTGG - Exonic
917281893 1:173385592-173385614 CTTCGGGAGGCCGAGGCAGCTGG + Intergenic
917936946 1:179877781-179877803 ATTCGGGCCGCGGCGGCCGCTGG - Exonic
917975587 1:180235555-180235577 CTTCGGAGCGGGGAGGCCGCCGG + Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
921491201 1:215778293-215778315 CTTTGGGACGCCGAGGCAGCCGG - Intronic
922135865 1:222825744-222825766 CTTTGGGAGGCCGAGGCCGCCGG - Intergenic
922618349 1:226976420-226976442 CTTCGGGGCTGCGGGGCTGCGGG + Intronic
923360724 1:233208200-233208222 CTTCGGGAGGCCGAGGCCGGTGG - Intronic
923461756 1:234214653-234214675 CTGCGGGGCGCCGGGGCTGGGGG + Intronic
923799385 1:237192456-237192478 CTTCGGGAGGCCGAGGCCGGTGG - Intronic
1063765721 10:9137934-9137956 ATTCGGGGCGCTGAGGCCGGAGG + Intergenic
1063881613 10:10537907-10537929 CTTGGGGGGTCCGTGGCCGCGGG + Intergenic
1065214771 10:23439148-23439170 CTTCGGCCCGCGGCGGCCGCTGG - Intergenic
1065829603 10:29602740-29602762 CTTCGGGGGGCCGAGGCAGTTGG + Intronic
1065884875 10:30068143-30068165 CTTCGGGGGGCCGAGGCAGGTGG + Intronic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1072021815 10:91410223-91410245 CTGTGGGGAGCCGCGTCCGCGGG + Intergenic
1072338182 10:94419114-94419136 CTTCGGGAGGCCGAGGCCGGTGG - Intronic
1074121689 10:110498105-110498127 CTTCATGCCGCCGCCGCCGCCGG - Exonic
1075106360 10:119542559-119542581 CTTCGGGGGCCCGCGGGCTCGGG - Intronic
1075403819 10:122180579-122180601 CTTCGGGACGCCGAGGCAGGTGG - Intronic
1075587219 10:123666605-123666627 CGTCGTGGCGCAGCGGCAGCCGG + Exonic
1075694394 10:124422881-124422903 CTTTGGGGGGCCGAGGCCGGAGG - Intergenic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1076593526 10:131608996-131609018 CTTCGGGACGCCGAGGCAGGTGG - Intergenic
1077085414 11:747619-747641 AATCGGGGCGCCGGGGCCTCTGG - Intronic
1077250064 11:1557012-1557034 CGGCGGGGGGCCGGGGCCGCCGG + Exonic
1077500612 11:2908289-2908311 CTTCGGGGTGCTGCAGCTGCTGG + Exonic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1078304668 11:10172594-10172616 CTTCGGGAGGCCGAGGCCGGTGG - Intronic
1079830975 11:25267231-25267253 CTTTGGGGGGCCGAGGCGGCCGG - Intergenic
1080467977 11:32516178-32516200 CTTTGGGGGGCCGAGGCAGCTGG - Intergenic
1082076608 11:47980451-47980473 CTGCGGAGCTCCGCAGCCGCCGG + Intergenic
1083272966 11:61581235-61581257 CTTCGGGCGGCGGCGGGCGCGGG - Intergenic
1083329583 11:61891351-61891373 CGTCGGGGAGCCGGGACCGCGGG - Exonic
1083939569 11:65888426-65888448 GCTCGGGGCGCTGCGGCCCCGGG - Exonic
1083971171 11:66076634-66076656 CTTTGGGAGGCCGAGGCCGCCGG - Intronic
1084156790 11:67317676-67317698 CTGCCGGGCGCTGCGGGCGCAGG - Intergenic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084620952 11:70270231-70270253 CGTAGGGGCGCCGCGGCGGGCGG + Intergenic
1084888484 11:72224996-72225018 CTGCGGGGCGCCGGGCCCGGGGG + Exonic
1088641651 11:111878907-111878929 CTTTGGGACGCGCCGGCCGCTGG + Intronic
1092244403 12:6855508-6855530 CTACCGGGCGCCGGGTCCGCCGG - Exonic
1094652118 12:32388834-32388856 CTTTGGGACGCCACGGCGGCTGG + Intergenic
1094820304 12:34219234-34219256 CTTCGGGGCTCCGGGTCCGGTGG + Intergenic
1100572749 12:95858556-95858578 TTTGGGGGCGCCTCTGCCGCAGG - Intergenic
1103595346 12:122021795-122021817 CCTCCGGGCGCCGCGGCCACCGG - Exonic
1104860672 12:131921760-131921782 CTGGGGGACGCCGAGGCCGCAGG - Exonic
1106243471 13:27927904-27927926 CTTCGGGCAGCCGAGGGCGCGGG + Intergenic
1107058440 13:36131018-36131040 CCTCGGCGCCCCGCGGCTGCGGG + Intronic
1108292556 13:48976057-48976079 CTCAGGGCCGCCGCGGCCGCCGG - Intronic
1110630110 13:77697884-77697906 CCCGAGGGCGCCGCGGCCGCCGG - Intronic
1111345622 13:86949946-86949968 CTTTGGGAGGCCGAGGCCGCCGG + Intergenic
1112472376 13:99700625-99700647 CTTCGGGGCCCCTCAGCTGCTGG - Intronic
1117252925 14:53953660-53953682 CCTGGGAGCGCGGCGGCCGCGGG - Intronic
1117302233 14:54441156-54441178 GTCCGGGCCGCCACGGCCGCCGG - Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1118809009 14:69260394-69260416 CCTCTGCGCGCCCCGGCCGCCGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1123036714 14:105474688-105474710 CCTGGGGGCGCCGCGGGGGCGGG - Intronic
1125606316 15:40941770-40941792 CTGCGGGGCACGGCGGCGGCAGG - Intergenic
1127045525 15:55021597-55021619 CTTTGGGGCGCCGAGGCGGGCGG + Intergenic
1127103192 15:55588064-55588086 CCTCGGGGCGGCGGGGCGGCGGG + Intronic
1128078334 15:64841863-64841885 CTTCGGGGGGGCGGGGCCGGGGG - Intronic
1128309656 15:66622255-66622277 CTCGGAGACGCCGCGGCCGCGGG - Intronic
1129933772 15:79432518-79432540 CTCCGAGGCGCCCCGGGCGCAGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131144533 15:90002329-90002351 CGTCGGGGCGCCGCGGGCCGGGG + Intronic
1132515286 16:363196-363218 CTGCGGGGCGCTGCGGCAGAGGG + Intergenic
1132585876 16:705584-705606 CGTCGGCGCGCGGGGGCCGCCGG + Exonic
1132765923 16:1534142-1534164 CCTCGGGGCGGCGCGGGCGGAGG - Exonic
1133812429 16:9170841-9170863 CTTCGGGGGGCCGAGGCAGGAGG + Intergenic
1135604165 16:23808800-23808822 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
1136188241 16:28600705-28600727 CTTCGGGCCTCCCCGGCCCCAGG - Intergenic
1136190713 16:28613699-28613721 CTTCGGGCCTCCCCGGCCCCAGG - Intronic
1136536341 16:30902113-30902135 CTTCTCGCCGCCGCGGCTGCCGG + Exonic
1140092013 16:71846288-71846310 CTCCGGGGCGCCGGGGCCTGAGG - Intronic
1141531366 16:84648802-84648824 AGTGGGGGCGCCGCGGCCGGGGG + Intronic
1142188438 16:88706041-88706063 ACTCGGGGCGCCGGGGCCTCGGG - Intronic
1142268971 16:89079314-89079336 CCTCGGGGTGCCCCGGCCACGGG - Intergenic
1142437600 16:90071947-90071969 CTTCGGGAGGCCGCGGCAGGCGG + Intronic
1142586873 17:979479-979501 CTGCGGGGGGACGCGGCGGCCGG - Exonic
1144862544 17:18314727-18314749 CTTCGGGCCGTCGCAGCCACCGG + Exonic
1144963896 17:19063385-19063407 CTTCGGGAGGCCGAGGCCGGCGG + Intergenic
1144984168 17:19189486-19189508 CTTCGGGAGGCCGAGGCCGGCGG + Intergenic
1145107645 17:20132980-20133002 CTTCGGGAGGCCGAGGCGGCAGG - Intronic
1145110353 17:20156450-20156472 CACCTGGGCGCCGGGGCCGCCGG + Intronic
1145936502 17:28717657-28717679 CGTCGGGTCTCCGCGGCCCCGGG - Intronic
1147139573 17:38453765-38453787 CTTCGGGGCCCCCGGGCCCCGGG + Intronic
1148769014 17:50056314-50056336 CTACGGAGCGCAGCGGCCGGCGG + Intronic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1151791426 17:76308098-76308120 CCTCGGGGCGCCCCTGCCCCGGG + Intergenic
1152400115 17:80061100-80061122 CTTTGGGAGGCCGAGGCCGCTGG + Intronic
1152719885 17:81918234-81918256 CTTTGGGGCGACGCGGCGGGCGG - Intronic
1153382621 18:4455440-4455462 CTACGGCGCGGCGCGACCGCGGG + Intergenic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155999594 18:32370187-32370209 CTTTGGGGGGCCGAGGCCGGCGG + Intronic
1156502063 18:37566290-37566312 ATTCCGGGCCCGGCGGCCGCGGG + Intergenic
1157338167 18:46756514-46756536 CTACCGGGCGCCGCGGGCGCGGG + Exonic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1160631110 18:80247055-80247077 CCTCTGAGCGCCGCGGCTGCCGG + Intronic
1160799114 19:959586-959608 CTTCTGGGCTCCGGGACCGCGGG + Intronic
1160853549 19:1206054-1206076 CCGCGGGGCGGCGCGGCGGCGGG - Intronic
1160875774 19:1295629-1295651 CTATGGGGCGCCGCTGCCGCCGG + Exonic
1160912664 19:1482032-1482054 CCTCGGGGAGCCGCCGCGGCAGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1160997612 19:1890862-1890884 CTTTGGGGGGCCGAGGCCGGTGG - Intergenic
1161175892 19:2841891-2841913 CTCCGAGGCGTCGCGGCCCCGGG - Intronic
1161175902 19:2841927-2841949 CTTCGGGACCCCCGGGCCGCGGG + Intronic
1163602637 19:18258090-18258112 CTCCAGGGCCCCGCGGACGCTGG - Exonic
1163711099 19:18847327-18847349 CTTCAGGGCGCTGCTGCTGCAGG + Intronic
1163898343 19:20078877-20078899 CTTTGGGGCGCCGAGGCGGGCGG + Intronic
1165242792 19:34481511-34481533 CTGCGGGGCGCCCGGGCCGTCGG - Intergenic
1166199374 19:41226424-41226446 CTTCAGGGCGCGGAGGCTGCGGG + Intronic
1166520265 19:43475359-43475381 CTTCGAGGCTCCGCCGGCGCGGG - Exonic
1167781413 19:51601424-51601446 CCTGGAGGCGCCGCGGCCGTCGG + Intergenic
925609927 2:5693862-5693884 CTGGGGGGCGGCGCGGCGGCCGG + Exonic
926090495 2:10045738-10045760 GGTCAGGGCGCCGCGGCCACTGG + Intronic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
928094179 2:28393800-28393822 CTGCTGGCCGCCGCCGCCGCTGG - Exonic
930012124 2:46945489-46945511 CTTCGGGAGGCCGAGGCGGCTGG - Intronic
930651765 2:53970868-53970890 CTTCGTCGCCCTGCGGCCGCTGG + Intronic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
934074742 2:88418375-88418397 CTTCGGGAGGCCGAGGCGGCTGG + Intergenic
935137651 2:100321814-100321836 GCTCGGGGCGCTGCGGCCGGAGG - Exonic
936278724 2:111120774-111120796 CCCCTCGGCGCCGCGGCCGCCGG - Intronic
942651927 2:178178161-178178183 CTTCGGGAGGCCGAGGCGGCCGG + Intergenic
944154047 2:196592852-196592874 CCGCAGGGCGCCGGGGCCGCGGG - Intronic
944412731 2:199458861-199458883 CTTCGTGCCGCCGCGCGCGCAGG + Intronic
944412849 2:199459319-199459341 CTGCCGGCGGCCGCGGCCGCGGG - Intronic
947724210 2:232387452-232387474 CTCCATGGCGCCGAGGCCGCCGG + Intergenic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948467433 2:238159062-238159084 CTGCTGGCCGCCGCCGCCGCGGG + Exonic
948467453 2:238159111-238159133 CCTCGAGGAGCCGCGCCCGCAGG + Exonic
948477818 2:238231715-238231737 CTCCGGGCCGCGGCGGCCTCTGG + Intergenic
948801824 2:240436519-240436541 TTTCGGGGCGCCGCTGACGGTGG + Intronic
1168965260 20:1894800-1894822 CTTCGGGGCTCCGGCCCCGCCGG - Intronic
1170688274 20:18588282-18588304 CTTCGGGGCAGCGCGGCGGCCGG + Intronic
1170999320 20:21396996-21397018 ATGCGGGGCGGCGCGGCCACCGG - Exonic
1171123708 20:22584899-22584921 GTGCGGGGCGCCGCGGCGGTGGG - Intronic
1172284639 20:33732129-33732151 CTAGGGCGCGCAGCGGCCGCGGG + Intronic
1173210743 20:41029478-41029500 CTCCGGGGCCCCCCAGCCGCCGG + Intronic
1179730583 21:43365200-43365222 CTTCTGGGCGCCAAAGCCGCAGG - Intergenic
1179810424 21:43865812-43865834 TTTCGGGGCGCGGCGGACCCGGG + Intronic
1180042858 21:45288711-45288733 CTGCGGGGAGCGGCGGCGGCGGG - Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1182499665 22:30737257-30737279 CTTTGGGACGCCGAGGCTGCAGG - Intronic
1182636712 22:31733546-31733568 CTTCGGGGGGCCGAGGCGGGTGG - Intronic
1183093700 22:35540361-35540383 CTCCGGGGCGCCGCGGTCTGCGG - Intergenic
1183201290 22:36387397-36387419 CTTCCGGGAGCCGCGGCCCCTGG - Intronic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183370101 22:37427332-37427354 CTCCGGGAAGCGGCGGCCGCGGG + Exonic
1183484231 22:38080827-38080849 CTTCGGGGCGCACCGGCAGAGGG + Exonic
1184537067 22:45094492-45094514 CTGCGTGGCGCTGTGGCCGCGGG - Intergenic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185272752 22:49936273-49936295 CTTCGGGGAGCCCCCGCCCCCGG - Intergenic
949703956 3:6794024-6794046 CTTCGGGAGGCCGAGGCCGGTGG + Intronic
951527871 3:23671176-23671198 CTTCGGGAGGCCGAGGCTGCAGG + Intergenic
951644912 3:24879184-24879206 CTTTGGGAGGCCGCGGCCGGCGG + Intergenic
952942293 3:38454071-38454093 CTCCGGGGCGACGCGGGGGCCGG - Exonic
953485002 3:43286696-43286718 CGGCGGGGCGCGGCGGCCGTAGG + Intronic
954186331 3:48919426-48919448 CCTAGGGGCGCCGCGGGCTCCGG - Intronic
954194704 3:48989784-48989806 TTTGGGGGCGCCGCGGAGGCTGG - Intergenic
954912526 3:54121840-54121862 CTGTCGGGCGCCGCGGCCGGAGG + Intergenic
960120837 3:113947793-113947815 CTTCCCGGCGCCAGGGCCGCGGG + Intergenic
960672144 3:120164623-120164645 CTTCGGGAGGCCGAGGCGGCCGG - Intronic
960896760 3:122514425-122514447 CTGCGGGGCGCCGAGGCAGCGGG - Intronic
960914279 3:122680924-122680946 CTTCGGGGGGTCGGGGCCCCAGG - Exonic
961067015 3:123884247-123884269 CGGCGGGGCGCCCCGGCCGCAGG + Intronic
961656460 3:128445176-128445198 CTTTGGGGGGCCGAGGCCGGAGG - Intergenic
961674301 3:128555496-128555518 CTTCCTGGCGGGGCGGCCGCGGG - Intergenic
961931582 3:130539390-130539412 CTTCGGGAGGCCGAGGCCGGTGG + Intergenic
962586786 3:136849859-136849881 CTTCGGGAAGCCGCGGCGGGCGG + Intronic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
966696332 3:182793713-182793735 CCGCGGGGCGCGGGGGCCGCGGG - Exonic
967527691 3:190513936-190513958 CTTCCAGGAGCTGCGGCCGCGGG - Intergenic
968435767 4:588209-588231 CCTCTGGGCACCGCGGCCTCAGG - Intergenic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968965317 4:3766469-3766491 CTGCTGGGCGCCGCGGTCCCCGG + Exonic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969379111 4:6782810-6782832 CTGCCGGGCGGCGCGGCGGCCGG - Exonic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
970346799 4:15160125-15160147 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
972551245 4:40136629-40136651 CTTCGGGGGGCCGAGGCGGGTGG - Intronic
977700444 4:100016048-100016070 CTTCGGGAGGCCGCGGCAGGTGG - Intergenic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985727591 5:1524101-1524123 CTGTGGGGGGCCGGGGCCGCTGG + Intergenic
986330615 5:6713912-6713934 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
990148359 5:52788213-52788235 CTCCTGGGCGCCGCTGCCACTGG + Exonic
990215889 5:53531325-53531347 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
994364796 5:98900693-98900715 CTTTGGGGGGCCGAGGCCGATGG - Intronic
995342258 5:111073034-111073056 CTCCGGGACGCCGCCGCCGGGGG + Intronic
995854238 5:116575796-116575818 TTTCGGGGCGCAGCGGCAGGGGG - Intergenic
996475887 5:123920134-123920156 CTTCGGGAGGCCGAGGCCGGCGG - Intergenic
1002133599 5:177095585-177095607 CTGGGGGGCGCCGGGCCCGCAGG - Exonic
1002348144 5:178562309-178562331 CTTTGGGACGCCGAGGCCGGCGG + Intronic
1002385029 5:178860182-178860204 CCTCGGAGCCCCGCGGCCTCAGG - Intronic
1002638330 5:180618985-180619007 CTGCGGGGCGCCGCGGGCGGCGG - Intronic
1003556022 6:7141103-7141125 CGTCAGGGCTCCACGGCCGCAGG + Intronic
1006665085 6:35688264-35688286 CGCCGGGACGCCGCGGGCGCGGG - Intronic
1006814292 6:36839964-36839986 CTCCGGGGCGCCCGGGCTGCGGG + Exonic
1007079419 6:39088285-39088307 CTTCGGGGGGCCGGGGGAGCGGG - Intergenic
1007154063 6:39725208-39725230 CTCCGGGGCGCCGGCGCGGCGGG - Intronic
1007429944 6:41770904-41770926 CCTTGGGGAGCCGCGGCGGCGGG + Exonic
1007644363 6:43369165-43369187 CCTCAGGGCACCGCGGCCGCCGG - Exonic
1007927656 6:45663282-45663304 CCTGGGGGCGCCGAGGCTGCGGG - Intronic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1010781175 6:79947422-79947444 CCTCAAGGCGCCGCGGCGGCGGG + Exonic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1015999628 6:139029436-139029458 CTTCGGGGCGCCCGGGCCACGGG + Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1023962849 7:44941841-44941863 CTTTGGGACGCCGAGGCCGGCGG + Intergenic
1027236718 7:76302808-76302830 CTTCGGGCTGCCCCGGCTGCCGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029305557 7:99617091-99617113 CTACGGGGCTCGGCGGCAGCGGG + Intronic
1030033167 7:105387979-105388001 CTTGGGTGCGCTGCGGGCGCCGG - Intronic
1031317291 7:120273415-120273437 CTGCGGGGCGGCGGGGCTGCGGG - Intergenic
1031484616 7:122311881-122311903 CCTCGGGTCACCGTGGCCGCGGG - Intergenic
1032013572 7:128361664-128361686 CGCCGGGGCTCCGCGGCAGCCGG + Exonic
1034344549 7:150378584-150378606 CTTTGGGAGGCCGAGGCCGCAGG + Intronic
1034578293 7:152020607-152020629 CTTCGGGAGGCCGAGGCGGCCGG - Intergenic
1034598336 7:152221009-152221031 CTTTGGGGGGCCGAGGCGGCAGG + Intronic
1034617934 7:152435530-152435552 CGCCGGGGCGCGGAGGCCGCGGG + Intronic
1035266004 7:157690617-157690639 CCTCGGGGCGCAGCAGCTGCGGG + Intronic
1035266549 7:157692849-157692871 CTCGGGGGCGGCGCGGCGGCGGG + Intronic
1035453979 7:158997222-158997244 CTCCGGGGAGCCCCTGCCGCAGG + Intergenic
1036930572 8:12951840-12951862 CTTCTTCCCGCCGCGGCCGCAGG - Intronic
1037811385 8:22089155-22089177 CCTCGTCGCGCCGGGGCCGCCGG + Intronic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1040077170 8:43247484-43247506 CTTCGGGGCTACGGGGCTGCGGG - Intergenic
1041354056 8:56981321-56981343 CTTCGGGAGGCCGAGGCGGCTGG + Intronic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1048073570 8:131043929-131043951 CTTCGGGAGGCCGAGGCCGGCGG + Intergenic
1049593929 8:143474906-143474928 ATTACGGGCGCCGCGGCCCCAGG + Intronic
1049729444 8:144168374-144168396 CCTCGGGGAGGCGCGGCCGGTGG + Exonic
1049762059 8:144336213-144336235 CTTGGGGGGGCTGCGGCGGCAGG + Exonic
1055081447 9:72271243-72271265 CTTTGGGAGGCCGAGGCCGCTGG + Intergenic
1055098610 9:72440221-72440243 CTTCGGGAGGCCGAGGCCGGCGG - Intergenic
1055574453 9:77647814-77647836 CGACGGGGCGACGCGGCCCCGGG + Exonic
1056711043 9:88991800-88991822 CTTGGGCGCGCCACGGCGGCCGG + Intronic
1058361364 9:104150362-104150384 CTTTGAGGCGCCGCGGCAGGTGG - Intergenic
1058937189 9:109780222-109780244 CTCCCGGTCGCCGCCGCCGCCGG - Intronic
1059209966 9:112504430-112504452 CTTCGGGAGGCCGAGGCCGGTGG - Intronic
1059633932 9:116154327-116154349 CGGCGAGGCGCGGCGGCCGCGGG - Exonic
1060106768 9:120877400-120877422 CTGCGGAGCCCGGCGGCCGCGGG - Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061961906 9:133992808-133992830 CTCCGGGGCGCTGGGGGCGCAGG + Intergenic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1062435957 9:136546649-136546671 GATGGGGGCGCCGCGGCCTCTGG + Intergenic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1185753775 X:2636145-2636167 CTTTGGGGCGCCGAGGCGGGTGG + Intergenic
1187826144 X:23334633-23334655 CTCCGGGAGGGCGCGGCCGCGGG + Exonic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic
1191213268 X:57910267-57910289 CTTGGGGGCCCCGGGGCAGCAGG + Exonic
1195702621 X:107716472-107716494 TTTCACGGCGCAGCGGCCGCAGG + Intronic
1197746075 X:129932705-129932727 CCTCGGCGCCCCGTGGCCGCAGG + Intergenic
1200277860 X:154751159-154751181 CCTCCGGCCGCCGCGGCCCCCGG + Intronic