ID: 1185259262

View in Genome Browser
Species Human (GRCh38)
Location 22:49852898-49852920
Sequence GCCTGCAGCCGGGTTTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185259262_1185259272 17 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259272 22:49852938-49852960 ACAGTCGGCGTGCGGGTGAAGGG 0: 1
1: 0
2: 1
3: 2
4: 42
1185259262_1185259271 16 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259271 22:49852937-49852959 AACAGTCGGCGTGCGGGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1185259262_1185259270 10 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259270 22:49852931-49852953 CTTTGGAACAGTCGGCGTGCGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1185259262_1185259275 30 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259275 22:49852951-49852973 GGGTGAAGGGGCACAGCCGCGGG 0: 1
1: 0
2: 3
3: 14
4: 228
1185259262_1185259273 18 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259273 22:49852939-49852961 CAGTCGGCGTGCGGGTGAAGGGG 0: 1
1: 0
2: 1
3: 1
4: 68
1185259262_1185259269 9 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259269 22:49852930-49852952 ACTTTGGAACAGTCGGCGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 56
1185259262_1185259268 2 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259268 22:49852923-49852945 GACGTGGACTTTGGAACAGTCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1185259262_1185259274 29 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259274 22:49852950-49852972 CGGGTGAAGGGGCACAGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 166
1185259262_1185259267 -7 Left 1185259262 22:49852898-49852920 CCATAGAAAACCCGGCTGCAGGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1185259267 22:49852914-49852936 TGCAGGCTGGACGTGGACTTTGG 0: 1
1: 0
2: 3
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185259262 Original CRISPR GCCTGCAGCCGGGTTTTCTA TGG (reversed) Intergenic
900087590 1:905843-905865 GCCTGGAGCAGGGTCTTCTGGGG + Intergenic
902723597 1:18321018-18321040 GCATGCTGCCTGCTTTTCTAGGG + Intronic
905514438 1:38551717-38551739 ACACGCAGCCGTGTTTTCTAGGG + Intergenic
905941568 1:41867384-41867406 GCCTGCCGCCTGTTTTTATATGG - Intronic
906991365 1:50742867-50742889 GCCTGCTGCCTGTTTTTGTATGG + Intronic
917656055 1:177126818-177126840 GCCTCAAGCCCTGTTTTCTAGGG + Intronic
924258829 1:242209297-242209319 CCCTGCAGCCAGGAATTCTAGGG + Intronic
1063819522 10:9819037-9819059 GCCTCCTGCCGGGATTTCTGAGG - Intergenic
1065114444 10:22471243-22471265 GCCTGCTACAAGGTTTTCTAGGG - Intergenic
1066191026 10:33056361-33056383 CCCTGCAGCCAGGCTTTCTGAGG - Intergenic
1066418105 10:35239535-35239557 CCCTGCAGCCAGGCTTTCTGAGG - Intergenic
1072878877 10:99203954-99203976 GCCTATAGCCTGGGTTTCTAGGG - Intronic
1075362814 10:121854748-121854770 GCCTGCAGCTTGATTTTTTAGGG - Intronic
1076729164 10:132429691-132429713 GCCTGCAGCCTGGCTTGCCAGGG - Intergenic
1080281226 11:30559206-30559228 CCCTGCAGCTGGGTGTTTTAGGG - Intronic
1089149841 11:116356196-116356218 GCCTGCCCCATGGTTTTCTATGG - Intergenic
1089286332 11:117410171-117410193 CCCTGCAGCCAGGAGTTCTATGG + Intronic
1091259960 11:134225699-134225721 GCCTGCAGGTGGGTTTGTTAGGG + Intronic
1091857855 12:3753405-3753427 GGCTGCTGCCGGGTTTTCGGGGG - Intronic
1092881007 12:12887941-12887963 TCCTGCAGCCGGGAATTCCAAGG + Intergenic
1096020032 12:48316338-48316360 GCCTGCTGCCTGTTTTTGTATGG - Intergenic
1098217492 12:68235796-68235818 GCCTGTAGCTGGTTTTTGTAAGG + Intergenic
1098335778 12:69403074-69403096 GCCTGCTGCAAGGTTTTGTATGG - Intergenic
1111430214 13:88139557-88139579 GCCTGCAGCCTTGTTTTCAGGGG + Intergenic
1112455667 13:99560326-99560348 GCCTGGAGTCGGGTTTTGAAGGG + Intronic
1119704295 14:76774362-76774384 GCCTGCAGCCTGAATTTCTCGGG - Intronic
1119903774 14:78283318-78283340 GCTTGCAGCCTGGTTTTGTATGG + Intronic
1120854949 14:89204147-89204169 GCCTGAAGCTCGGGTTTCTAAGG - Intronic
1121244523 14:92452278-92452300 GCCTGAAGCTGCGTTTTCTGTGG + Intronic
1124254456 15:28129598-28129620 GCCTGCAGCAGGTCTGTCTAAGG + Intronic
1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG + Intergenic
1126435844 15:48636694-48636716 GCCTGCAGCCCTGTTTACTTGGG - Intronic
1126672587 15:51129725-51129747 GCTTGCAGCAGAATTTTCTAGGG + Intergenic
1127404862 15:58632446-58632468 GCCAGCAGCCTGTTTTTATATGG + Intronic
1128288313 15:66457032-66457054 GCCTGCTGCCTGTTTTTGTATGG + Intronic
1128880344 15:71236753-71236775 GCCTGCAGCCTGGTCAACTAAGG + Intronic
1132091619 15:98952044-98952066 GCCTGCTGCCTAGTTTTCCAAGG - Intronic
1133104707 16:3500054-3500076 CACAGCAGCCGGGTTTTGTAAGG - Intergenic
1134099607 16:11442745-11442767 GCCTGCAGATGGGTTTTGTTTGG - Intronic
1134819347 16:17233569-17233591 GCCTGCAGACAGCTTTTCTTGGG + Intronic
1135905032 16:26503919-26503941 GTCTGCAGGCAGGTTTTCTTTGG - Intergenic
1144294600 17:13861630-13861652 GCCTGTAGCCTGATTTTGTATGG - Intergenic
1147971814 17:44222236-44222258 GCCTGCGGCCTGCTTTCCTAGGG - Intergenic
1148199499 17:45740533-45740555 GGCTCCAGCCGGTTTTTATATGG + Intergenic
1150210894 17:63440904-63440926 GCCTGCAGCCAGGCTCTCTGGGG - Intronic
1150653118 17:67022727-67022749 CCATGCAGCCGAGATTTCTACGG + Intronic
1151710176 17:75800032-75800054 GCCTGCTGCCTGCTTTTTTAAGG + Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1155087907 18:22475473-22475495 GCCTGCAGCCCATTTTTGTAAGG + Intergenic
1157662120 18:49454598-49454620 GCCTGCAGCAGATTTTTATATGG - Intronic
1158845987 18:61443467-61443489 GCCTGCAGTCATGTTTTCTTTGG - Intronic
1159408341 18:68035941-68035963 GCCTCCAGCTGTGTTTTCTAAGG - Intergenic
1165279820 19:34786368-34786390 CACTGCAGCGGGGTGTTCTAGGG - Intergenic
1165821360 19:38678400-38678422 TCCTGCAGCTGGGTTTACTATGG + Intronic
1165849252 19:38839934-38839956 GCTTGCAGACGGGTTTTGTTTGG - Intronic
1166255892 19:41604286-41604308 GCCTGCATCCTAGTTTTCCATGG - Intronic
925843020 2:8009948-8009970 TCCTGCAGTCGAGTCTTCTAGGG + Intergenic
932806736 2:74791051-74791073 GCCTGCTGCCTGTTTTTGTATGG - Intergenic
936057604 2:109272586-109272608 GCCTGCAGCAGGGTCTCCAAAGG - Intronic
936173520 2:110197728-110197750 GCCTGCAGCTAGGTTCTCTCAGG - Intronic
936547483 2:113405049-113405071 GCCTGCAGCCTGGGGTTCTGGGG - Intergenic
938128844 2:128693765-128693787 GCCTGCAGCCTGCTTTTCTAGGG - Intergenic
938580232 2:132639116-132639138 GGCCCCAGCCTGGTTTTCTAAGG - Intronic
938724394 2:134094197-134094219 GCCTGAAACAGTGTTTTCTATGG - Intergenic
943652047 2:190467681-190467703 GCCTGCTGCCTGTTTTTATATGG + Intronic
947546925 2:231016738-231016760 GCCTGCAGCCAGGCCTTCTAGGG + Intronic
948481313 2:238252183-238252205 GCCTGCAGTCTGGGTTTCCAAGG - Intronic
1172046851 20:32086549-32086571 GTCTGCAGCTGGGCCTTCTAGGG + Intronic
1173451106 20:43164882-43164904 GCCTGCTGCCTGTTTTTGTATGG - Intronic
1173805122 20:45919865-45919887 GCCTCCAGCTGTGTTTTCTTTGG + Intergenic
1174042353 20:47708964-47708986 GACTGAAGCCCTGTTTTCTAGGG - Intronic
1175552657 20:59827267-59827289 TCCTGGAGCCGGGTGTTCCAAGG - Intronic
1175926581 20:62474325-62474347 GCCAGCAGCCGGGCTGTCCAGGG + Intronic
1179289494 21:40006204-40006226 GCCTGCTGCCCGGTGTACTAAGG + Intergenic
1180135143 21:45857638-45857660 GGGTGCAGCCTGGTTTTATATGG - Intronic
1184895258 22:47402943-47402965 GCCTTCAGTGGGGTTTTCTCAGG + Intergenic
1185259262 22:49852898-49852920 GCCTGCAGCCGGGTTTTCTATGG - Intergenic
949539052 3:5018068-5018090 GCCTAGAGCTGGGCTTTCTAAGG - Intergenic
950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG + Intronic
954580876 3:51702377-51702399 GCCAGCAGCCTGGGCTTCTAGGG + Intronic
957110327 3:75947386-75947408 GCCTGCTGCCTGTTTTTGTATGG + Intronic
968952343 4:3701613-3701635 TCCTCCAGCCTTGTTTTCTAAGG - Intergenic
970803297 4:20002228-20002250 GCCTGCAGCAGGGTTGACTTGGG - Intergenic
979104308 4:116664827-116664849 GCCTGAAGCAGAGTTTTCTGGGG - Intergenic
981943812 4:150317108-150317130 GCCTGCACCCTGGTTTTTTCAGG + Intronic
985391709 4:189497228-189497250 CCCTCGAGCAGGGTTTTCTAGGG + Intergenic
985711019 5:1430042-1430064 GCCTGCAGCTGCGCTTCCTATGG + Intronic
987135560 5:14896691-14896713 GTCTGCATCCTAGTTTTCTATGG - Intergenic
995730369 5:115233618-115233640 GCCTGCAGTCTGGATTTGTATGG + Intronic
997281820 5:132653793-132653815 TCCTGCAGCAGGGTTTTCTCCGG + Intergenic
997506148 5:134418878-134418900 GCCTGCAGCCTGTTTTTGCAGGG - Intergenic
1001014604 5:168128703-168128725 GCCTGCTGCCTGTTTTTCCATGG + Intronic
1001453814 5:171845881-171845903 GCCTGCATCCTGTTTTCCTAGGG - Intergenic
1001849916 5:174954681-174954703 GCCTCCAGACGTGTTTTCTTTGG - Intergenic
1002179940 5:177426234-177426256 GCTCGCAGACGGCTTTTCTAGGG - Intronic
1002784776 6:392616-392638 GCCTGCGGCCGGGCGTTCCAGGG - Intronic
1010332432 6:74639425-74639447 GCCTGCTGCCTGTTTTTATATGG + Intergenic
1010868087 6:81005217-81005239 ACCTGCAGTCGGATGTTCTAGGG - Intergenic
1012046727 6:94285247-94285269 GTCTGCAGCCTGCTTTTATAAGG + Intergenic
1012746037 6:103090825-103090847 TCCGGCATCCTGGTTTTCTATGG - Intergenic
1019314158 7:376876-376898 ACCTGAAGCCGGGGTTTCTGAGG + Intergenic
1021508743 7:21412631-21412653 GACTGCAGCCTGGTGTTCTGAGG - Intergenic
1022112322 7:27239404-27239426 GCCTGCAGCGGGCCTTTCAACGG - Intergenic
1029333395 7:99879073-99879095 GTCTGCAGTCAGATTTTCTAGGG + Intronic
1029524596 7:101087304-101087326 GCCTGCAGCATGGTTTCCCACGG + Exonic
1030115677 7:106060574-106060596 GCCTGCAGCCAGGTCTGCCAAGG + Intergenic
1033865675 7:145687751-145687773 GCCTGCAGCAAAGTTTGCTATGG - Intergenic
1034265613 7:149779284-149779306 GCAGGCAGCCGGGCTTTCTGTGG - Intergenic
1035021915 7:155805269-155805291 GCCTGCAGCCGGGAGCTCTCCGG + Intronic
1035760596 8:2065988-2066010 GGCAGCAGCAGGGTTTTCAAGGG + Intronic
1036163268 8:6407819-6407841 GCCTGCTGCCTGTTTTTGTAAGG + Intronic
1037873395 8:22521403-22521425 GACTGGAGCCGGGTTTACAAGGG + Intronic
1037905759 8:22715250-22715272 GACTGCAGCCGGGTTCTCCTAGG + Intronic
1042330910 8:67579686-67579708 GCCTGCTGCCTGTTTTTCTATGG + Intronic
1044583604 8:93847540-93847562 GCCTGCAGCATGGTATTTTATGG + Intergenic
1047290676 8:123527132-123527154 GCCTGCCGCCTGTTTTTGTATGG - Intronic
1047472137 8:125186057-125186079 GCCTGCCTCCTGATTTTCTATGG + Intronic
1048342571 8:133552128-133552150 CCCTGCAGTGGGCTTTTCTAGGG - Intronic
1049448263 8:142641592-142641614 GCCTGCAGTCAGCTTGTCTAGGG + Intergenic
1050123761 9:2335258-2335280 GACTGCAGTGGGGTTTTGTAAGG + Intergenic
1051731645 9:20149743-20149765 GCCTGCTGCCTGTTTTTGTATGG - Intergenic
1059553532 9:115254655-115254677 GCCTGCTGCCTGATTTTTTATGG - Intronic
1187020726 X:15378727-15378749 ACCTGCAGCCTGTTTTTGTATGG + Intronic
1189121878 X:38403998-38404020 GCCTACAGCAGGGTATTCAAAGG - Intronic
1196831651 X:119780590-119780612 GCCTGCACCCAGTTTTCCTATGG + Intergenic
1197673279 X:129302358-129302380 GCCTGCAGCTGGGTTTTGTTTGG + Intergenic