ID: 1185260484

View in Genome Browser
Species Human (GRCh38)
Location 22:49859084-49859106
Sequence AACAGCATGTGGAGGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185260484_1185260494 16 Left 1185260484 22:49859084-49859106 CCATCAGACCTCCACATGCTGTT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1185260494 22:49859123-49859145 ACCTGTGGGCAGTGGCACCTTGG 0: 1
1: 1
2: 0
3: 25
4: 220
1185260484_1185260488 1 Left 1185260484 22:49859084-49859106 CCATCAGACCTCCACATGCTGTT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1185260488 22:49859108-49859130 GCTGGTCTCCCCAGAACCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 222
1185260484_1185260489 2 Left 1185260484 22:49859084-49859106 CCATCAGACCTCCACATGCTGTT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1185260489 22:49859109-49859131 CTGGTCTCCCCAGAACCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 210
1185260484_1185260490 8 Left 1185260484 22:49859084-49859106 CCATCAGACCTCCACATGCTGTT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1185260490 22:49859115-49859137 TCCCCAGAACCTGTGGGCAGTGG 0: 1
1: 0
2: 2
3: 35
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185260484 Original CRISPR AACAGCATGTGGAGGTCTGA TGG (reversed) Intronic
900485053 1:2918688-2918710 AACAGCACGTGGAGGCCGGTGGG - Intergenic
900501498 1:3007609-3007631 AACACCATGTGGAAGGCTTATGG - Intergenic
901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG + Exonic
902434712 1:16390856-16390878 AACAGCATGCTGAGTTCTGGGGG + Intronic
902780105 1:18699428-18699450 AACAGCATGTGCAAAGCTGAAGG + Intronic
903050266 1:20595340-20595362 AACAGCAGGGGGTGGTTTGAGGG - Intronic
906532503 1:46531814-46531836 ACATGCATGTGGAGGTGTGAGGG - Intergenic
910674431 1:89802396-89802418 AAAAGCATTTAGAGGGCTGATGG - Intronic
911802764 1:102164147-102164169 AAGATCATGGTGAGGTCTGAGGG + Intergenic
912362459 1:109106219-109106241 ACCGGCATATGGAGGACTGATGG + Intronic
915604857 1:156944087-156944109 AGCAGCACGTGGAGGTCTGGAGG + Exonic
915766239 1:158365470-158365492 AGCAGCAGGTGGAGATTTGAAGG - Intergenic
917867302 1:179209338-179209360 GACAGCGTGTAGAAGTCTGATGG - Intronic
918961227 1:191280667-191280689 AAAAGCCTCAGGAGGTCTGATGG - Intergenic
920193768 1:204212679-204212701 AATAGACTGTGGAGGTATGAAGG - Intronic
920694608 1:208172644-208172666 AACAGATTCTGGAGGGCTGAGGG + Intronic
921062930 1:211601121-211601143 AACAGAGTGGGGAGGTTTGAGGG - Intergenic
922242114 1:223762422-223762444 GGCAGCATGCGGAGGTCTTAGGG - Intronic
923106957 1:230861761-230861783 AACAGCTTGTGGAGGCCCTAAGG - Intronic
924374835 1:243394700-243394722 AACAGCATATGGACGTAGGATGG - Intronic
924383098 1:243481217-243481239 ACCAGCATTTGAAGGTCTGATGG + Intronic
924934853 1:248759048-248759070 ATAAGCATGTGGAGGTGTGTAGG + Intergenic
1063018628 10:2103677-2103699 CACAGTCTGTGGAGGTTTGAGGG + Intergenic
1063376932 10:5559725-5559747 GCCTGCATGTGGAGGTCTGTGGG - Intergenic
1066574217 10:36807679-36807701 AAGAGTAAGTGGAGGTGTGATGG - Intergenic
1070771356 10:79084316-79084338 AACAGAAAGAGGAGGTGTGAAGG - Intronic
1070817878 10:79336506-79336528 CACAGCATGGGGAGGTGTGGGGG + Intergenic
1074067878 10:110035134-110035156 AACACCAAGTGGAATTCTGAGGG + Intronic
1074457886 10:113611467-113611489 AACAGGATGTGGATGCCTGTTGG + Intronic
1076398194 10:130157161-130157183 TCCAGCATGTGGAGGGCAGATGG - Intronic
1077063167 11:626538-626560 GACAGCACGTGAGGGTCTGAGGG + Intronic
1078532819 11:12150044-12150066 AACAGATTGTGGTGGTTTGATGG + Intronic
1079533343 11:21481642-21481664 GACAGCATCTGGATGGCTGATGG + Intronic
1079548548 11:21665914-21665936 AAAAACAGGTGGAGGTTTGAAGG + Intergenic
1080189610 11:29527984-29528006 AACAGCATGTGTAGGTGTATGGG + Intergenic
1081635908 11:44721903-44721925 AACACCCTGTGGAGGTTAGAAGG - Intergenic
1084315004 11:68340564-68340586 GACAGGATGTTGAGGTCAGAGGG + Intronic
1084835785 11:71801023-71801045 TACAGCATGTAGAGGCCGGAAGG - Exonic
1086930377 11:92686436-92686458 AACAGGATGAAGAGGTCTCAGGG - Intronic
1089511022 11:118997374-118997396 AACAGGAAGTGAAGATCTGAAGG + Intergenic
1091142204 11:133244898-133244920 TACAGCCTGAGAAGGTCTGAGGG + Intronic
1091621370 12:2091847-2091869 AACAGCATCTAGGGATCTGAAGG + Intronic
1091757297 12:3062404-3062426 ATCTGCAAGTGGAGGTTTGAAGG - Intergenic
1091988942 12:4938798-4938820 AACTGGATGTGGAGGTGGGAAGG + Intergenic
1092407539 12:8231380-8231402 TACAGCATGTAGAGGCCGGAAGG + Intergenic
1095430874 12:42133404-42133426 AATAGGATGTGGAGCTCTTAAGG - Intronic
1096332174 12:50723259-50723281 CTGAGCATGTGGAGGTCTGACGG - Exonic
1101650420 12:106672457-106672479 AACAGCATGTGGTGTTCTTTAGG + Intronic
1102886745 12:116527810-116527832 AACCACATGTAAAGGTCTGAAGG - Intergenic
1107871120 13:44747458-44747480 AAGAGTATGTGAAAGTCTGAGGG - Intergenic
1109283299 13:60382069-60382091 AACAGCATGTGGGAGGCAGAAGG - Intergenic
1115064082 14:29233943-29233965 CACAGCAATTGGAGGTCTGAGGG - Intergenic
1115784578 14:36810146-36810168 AACAGCATGTCCAGATCTAAAGG + Intronic
1118572144 14:67204495-67204517 AACATCATCTGGAGACCTGATGG - Intronic
1118737315 14:68711306-68711328 AAGAGGAGGTAGAGGTCTGAAGG - Intronic
1120521328 14:85530915-85530937 AACAGCTTGTGGAGGGGAGAGGG - Intronic
1121677448 14:95765513-95765535 AACCCCTTGTGTAGGTCTGATGG + Intergenic
1121851748 14:97227774-97227796 AGCAGCAGGAGGAGGTCAGAAGG - Intergenic
1121991608 14:98563119-98563141 AAGAGCAGGTGGATGGCTGAGGG + Intergenic
1122413311 14:101536970-101536992 AACAGTATGTGGAGGAAGGAAGG + Intergenic
1127553364 15:60063073-60063095 AACAGCATGTGCAGAAATGATGG - Intergenic
1127673745 15:61220685-61220707 AACAGCAAGAATAGGTCTGAAGG - Intronic
1129946144 15:79540806-79540828 AATAGACTGTGGAGTTCTGAGGG + Intergenic
1130716127 15:86336581-86336603 ATCAGCATGAGGAGGGGTGAGGG + Intronic
1132118555 15:99157189-99157211 AACAGCAGGTGGAAATCTGGAGG + Intronic
1133616917 16:7485839-7485861 AACAGCAAGTGTCGGTCTGCAGG + Intronic
1136545846 16:30954187-30954209 TACAGGATGTGAAGGTCAGAAGG + Exonic
1138169915 16:54839208-54839230 GAATGCATGTGGAGGTGTGATGG + Intergenic
1138299006 16:55910870-55910892 CACAGCATGTGGAAGACTGGAGG + Intronic
1139272920 16:65700192-65700214 AACTGCATGTGGTGGACAGAAGG - Intergenic
1141534060 16:84666733-84666755 AACAGAATGTGTGGTTCTGAAGG + Intronic
1147036787 17:37687499-37687521 AGCAGCAGGTGGAGGGCTGGGGG + Intronic
1148784446 17:50139174-50139196 GTCAGCATGTGCAGGTGTGAGGG + Intronic
1149113715 17:53064974-53064996 GACAGCAGGTGGAGGTGGGAGGG + Intergenic
1152786380 17:82250070-82250092 AACAGCCTGTGCAGGTGTGGTGG + Intronic
1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG + Intronic
1157802210 18:50630022-50630044 AACAGCAGGTGAATGTGTGATGG + Intronic
1158299030 18:56031909-56031931 ACCAGCCTGTGCAGGGCTGAAGG - Intergenic
1158341150 18:56468036-56468058 AACAGCATGTGGAAGGAAGAAGG + Intergenic
1158587691 18:58755820-58755842 AACAGAGAGTGGAGGGCTGAGGG + Intergenic
1159350723 18:67269206-67269228 AACATCAAGTTGAGGGCTGAAGG - Intergenic
1164438361 19:28251876-28251898 AACAGCATGTGGAGAGCTTCTGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925086217 2:1109389-1109411 AAAAGGATGTGGAAGTCAGAGGG + Intronic
926705745 2:15836214-15836236 AAAAGCATGTGGAGGAATTATGG + Intergenic
928409206 2:31041420-31041442 AGCAGAATGGGGTGGTCTGAGGG + Intronic
931358110 2:61554737-61554759 GACAGCATGAGCAGGACTGAGGG - Intergenic
932484186 2:72071708-72071730 AACAGCATTAGGAGGTATGGTGG - Intergenic
934048322 2:88190130-88190152 ATCAGTGTGTGGTGGTCTGAAGG + Intergenic
935803923 2:106728161-106728183 TTCAGCACGTGCAGGTCTGACGG + Intergenic
936465756 2:112748040-112748062 AACAACATTTAGAGTTCTGAAGG + Intronic
937532660 2:122847758-122847780 TACATCTTGTGGAGGCCTGAAGG + Intergenic
937826702 2:126374454-126374476 AATGTCATGTTGAGGTCTGAAGG - Intergenic
938160841 2:128983242-128983264 GACAGCAGGTGGAGGAATGAGGG - Intergenic
938389723 2:130895227-130895249 AACAGCATGGTGAGGTCTCAAGG - Intronic
939644367 2:144678624-144678646 GACAGGATGAGGAGGTGTGAGGG - Intergenic
940874251 2:158884301-158884323 ACCAGCACCTGGAGGTCTGCGGG + Intergenic
943362042 2:186931477-186931499 ACCAGCAAGTGGAGCTCAGATGG - Intergenic
944422613 2:199547185-199547207 AGCACCATGTGGAGGCCTCATGG - Intergenic
944910360 2:204304951-204304973 AATAGCATGTGAATGCCTGAAGG + Intergenic
946148368 2:217747905-217747927 AGCTGCAGGTGGAGGTCTGGGGG - Intronic
948396868 2:237650939-237650961 AGGAGGATGTGGAGGCCTGAGGG - Intronic
948808086 2:240461508-240461530 CAGCACATGTGGAGGTCTGAGGG + Intronic
948813678 2:240499050-240499072 AACAGCACGTGGAAGTGTGTGGG + Intronic
948827820 2:240581938-240581960 TGCAGGATGTGAAGGTCTGATGG - Intergenic
1171237482 20:23539338-23539360 AGCAGCCTGTGGAGGTCAGAGGG + Intergenic
1171238651 20:23547838-23547860 AGAAGCAGGTGCAGGTCTGAGGG + Intergenic
1174140108 20:48406754-48406776 AGCAGCATGTTGAGGTCTCTTGG - Intergenic
1175865526 20:62174235-62174257 ACCAGCATGGCGAGGGCTGATGG - Intronic
1177056096 21:16303194-16303216 AACAGCCTCTGGATGTCTGCTGG + Intergenic
1177638403 21:23815515-23815537 GGGAGCATGTGTAGGTCTGAGGG + Intergenic
1181011370 22:20042897-20042919 CACAGCATGTGGGCCTCTGAGGG - Intronic
1182535939 22:31002978-31003000 AGAAGCAAGTGCAGGTCTGAGGG + Intergenic
1184711398 22:46251163-46251185 AACAGCATGTGAAAGGCTGCCGG - Intergenic
1184856054 22:47147437-47147459 TATAGCATGTGGTGGTCTGTCGG + Intronic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
949092900 3:50536-50558 TAAAGCATGTGTAGGTTTGAGGG - Intergenic
949440946 3:4079698-4079720 AACAGCATGTTGAGTACTTAGGG - Intronic
950768397 3:15291282-15291304 CACAGCATGTGGAGCTGTGGAGG - Intronic
951407770 3:22322387-22322409 AATAGTATCTGGAGGTCAGAAGG - Intronic
953878778 3:46681024-46681046 AACACCATGAGGAGGGGTGAGGG + Intronic
954520572 3:51221952-51221974 ACCAGAATATGGAGGTCTGCTGG - Intronic
957052586 3:75421754-75421776 TACAGCATGTAGAGGCCGGAAGG + Intergenic
957408988 3:79812290-79812312 CTCAGCATCAGGAGGTCTGATGG - Intergenic
959822605 3:110754452-110754474 TACAGACAGTGGAGGTCTGAAGG + Intergenic
960262281 3:115581338-115581360 CACAGCATGTGGAGGTATGTGGG - Intergenic
960442185 3:117702414-117702436 AACAGCATGTGGACTTCTGTAGG + Intergenic
961318654 3:126057450-126057472 AACAGAATGTTCAGGCCTGAGGG + Intronic
961568108 3:127778280-127778302 AACGGCCTGTGCAGGCCTGAGGG + Intronic
962429495 3:135306349-135306371 AACTGCAGGTGGAGATCAGAAGG + Intergenic
963117591 3:141744889-141744911 GACAGCATGTGGAGCTGTGTAGG + Intronic
965842100 3:172917966-172917988 AACAGCATATGTAGGTGTTAGGG - Intronic
969758599 4:9166664-9166686 TACAGCATGTAGAGGCCGGAAGG - Intergenic
969818567 4:9704127-9704149 TACAGCATGTAGAGGCCGGAAGG - Intergenic
970981844 4:22107928-22107950 AACAACATGTGTAGGTATGAGGG - Intergenic
972405824 4:38745798-38745820 AAGGGCATGTAGAGGTCTGCTGG + Intergenic
977193762 4:94032913-94032935 AGCAGCATGGGGTGGTTTGAGGG - Intergenic
977902685 4:102440370-102440392 AACAGGATTTGGGGTTCTGAAGG + Intergenic
982386179 4:154805090-154805112 AATAGCATGTGGTGGTTTAATGG + Intronic
984380974 4:178992531-178992553 AAGAGAATGTTAAGGTCTGATGG - Intergenic
987695781 5:21329501-21329523 AACACCATCTGAAGTTCTGATGG + Intergenic
991744621 5:69722591-69722613 AACACCATCTGAAGTTCTGATGG - Intergenic
991753082 5:69832642-69832664 AACACCATCTGAAGTTCTGATGG + Intergenic
991796192 5:70302315-70302337 AACACCATCTGAAGTTCTGATGG - Intergenic
991802700 5:70389369-70389391 AACACCATCTGAAGTTCTGATGG + Intergenic
991824003 5:70597905-70597927 AACACCATCTGAAGTTCTGATGG - Intergenic
991832402 5:70707761-70707783 AACACCATCTGAAGTTCTGATGG + Intergenic
991888570 5:71301874-71301896 AACACCATCTGAAGTTCTGATGG - Intergenic
991977726 5:72199457-72199479 AACAGTATGTGGAAGTATCAGGG - Exonic
996336451 5:122388839-122388861 GATAGCATGTGGAGGCCTGCTGG + Intronic
997150680 5:131491617-131491639 AACAGGAGGTGGAGGTCAGGCGG - Intronic
999031955 5:148303680-148303702 AACTGCCTTTGCAGGTCTGAAGG + Intergenic
1001137759 5:169116699-169116721 AACAAAAGGTTGAGGTCTGAGGG + Intronic
1001270601 5:170308567-170308589 AAGATCATGGGGAGGACTGAGGG - Intergenic
1001641403 5:173246428-173246450 AACAGCGCTTGGACGTCTGAAGG - Intergenic
1001831915 5:174796218-174796240 AACAGCATCTGAAGGTTAGATGG + Intergenic
1002772792 6:303890-303912 AACAGATTCTGGAGTTCTGATGG + Intronic
1003995979 6:11538992-11539014 AGCAGCAGCTGGAGGCCTGAGGG - Intronic
1004481007 6:16019243-16019265 AAGAGCATGTGGATTTCTGCGGG + Intergenic
1005155683 6:22803544-22803566 AACAGCATGAGCAAGACTGAAGG + Intergenic
1005555007 6:26968565-26968587 AACACCATCTGAAGTTCTGATGG - Intergenic
1007005902 6:38361985-38362007 AAAAGCAAGTGGAGGTGTGTTGG - Intronic
1007335348 6:41151451-41151473 AATATCCTGTTGAGGTCTGAGGG + Intronic
1007547180 6:42703424-42703446 AACAGCATGTGCAGGTGTTCAGG - Intronic
1010569054 6:77455903-77455925 AACAGGATGTATAGGTGTGAAGG - Intergenic
1011897784 6:92253445-92253467 AGCACCATATGGAGCTCTGATGG - Intergenic
1011977837 6:93328079-93328101 AACAGCCTGTGCAGGTCCCAAGG - Intronic
1015160887 6:130151173-130151195 AGCAGCATGCGGAGGTCTCATGG - Intronic
1015723329 6:136269950-136269972 AACAGCATTTGGAAGGATGAGGG - Intronic
1016987244 6:149904789-149904811 GAAAGGATGTGGAGGACTGACGG + Intergenic
1018658345 6:166062053-166062075 AACAGAATTTAGAGATCTGAAGG - Intergenic
1018912456 6:168110020-168110042 AACAGCATCTGGAGCCCTTAGGG - Intergenic
1019374377 7:681569-681591 ACAAGCATCTGGAGGTCTGCTGG + Intronic
1022126003 7:27358112-27358134 GACAGCCTGTTGTGGTCTGAAGG - Intergenic
1022473848 7:30697861-30697883 AGAAGCATGTGTAGGTGTGAGGG - Intronic
1024132471 7:46368645-46368667 ATGAGCATGTGGAGATATGAGGG + Intergenic
1025614660 7:63107301-63107323 AATGTCATGTTGAGGTCTGAAGG - Intergenic
1029549787 7:101231646-101231668 AAGAGCCTCTGGAGGTCTGTCGG - Intergenic
1030907920 7:115209263-115209285 GACATAATGTGGAGGTTTGAGGG - Intergenic
1036677478 8:10846943-10846965 CACAGCCTGTGGAGCTCTGTGGG + Intergenic
1036794183 8:11743434-11743456 CCCAGCAGGTGGAAGTCTGAGGG + Intronic
1036847917 8:12182298-12182320 TACAGCATGTAGAGGCCGGAAGG + Intronic
1036869285 8:12424613-12424635 TACAGCATGTAGAGGCCGGAAGG + Intergenic
1038611387 8:29062788-29062810 AATAGCATCTGGAGAACTGAGGG - Intronic
1039566998 8:38558930-38558952 ACCAGCCTGTGGGTGTCTGACGG - Intergenic
1040029805 8:42814051-42814073 CACAGTATGTGGAGGGCTGGGGG + Intergenic
1040108668 8:43555609-43555631 TACAGCATGTGGAGCTGTAAGGG + Intergenic
1041004983 8:53488817-53488839 AATGTCATGTTGAGGTCTGAAGG - Intergenic
1041453313 8:58031116-58031138 AACTGCATTTGGAGGACAGAAGG + Intronic
1043204628 8:77421766-77421788 GACAGCAGGTGGAGCTCAGATGG - Intergenic
1044197552 8:89395892-89395914 AACAGAATGTGGAAGTTTTAAGG + Intergenic
1044557543 8:93579955-93579977 AAAAGCATGAAGAGGTCTGAGGG + Intergenic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1048236285 8:132693892-132693914 CACAGCATGTGGAGACTTGAAGG + Intronic
1056091065 9:83206814-83206836 AACAGCTTCTGGAAGCCTGAAGG - Intergenic
1056605119 9:88079029-88079051 AACAGCATGTGGTGGCCTGTGGG - Intergenic
1056662160 9:88551981-88552003 CTCAGCATGTGGAGGTGGGAGGG + Intronic
1056825297 9:89872869-89872891 CACTGCATCTGGAGGTCTGCTGG + Intergenic
1060070562 9:120543422-120543444 AAGAGAATGTATAGGTCTGAGGG - Intronic
1061034583 9:128106557-128106579 GACAGCAGGTGGAGGTGTGCTGG - Intronic
1187590673 X:20713893-20713915 AACTCCATGAGGAGGTCTGGAGG + Intergenic
1193365940 X:80633369-80633391 AACAAAATGTGGGGATCTGATGG - Intergenic
1197943493 X:131813814-131813836 AACAGCAGCTGGAGGTCTCAGGG + Intergenic
1198157467 X:133975563-133975585 GGCACCATGTGGAGGCCTGAGGG - Intronic
1199353584 X:146833925-146833947 AAGGGGATCTGGAGGTCTGAAGG + Intergenic