ID: 1185260845

View in Genome Browser
Species Human (GRCh38)
Location 22:49861994-49862016
Sequence TGCTTAGTAATGCCCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185260845_1185260851 11 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260851 22:49862028-49862050 GCCAGGATGGTAGGGTGAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 351
1185260845_1185260853 12 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260853 22:49862029-49862051 CCAGGATGGTAGGGTGAGAAGGG 0: 1
1: 0
2: 1
3: 28
4: 314
1185260845_1185260854 13 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260854 22:49862030-49862052 CAGGATGGTAGGGTGAGAAGGGG 0: 1
1: 1
2: 1
3: 29
4: 461
1185260845_1185260849 2 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260849 22:49862019-49862041 TGGATTTTTGCCAGGATGGTAGG No data
1185260845_1185260847 -6 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260847 22:49862011-49862033 TAAGCATTTGGATTTTTGCCAGG 0: 2
1: 0
2: 1
3: 27
4: 456
1185260845_1185260855 25 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260855 22:49862042-49862064 GTGAGAAGGGGTATCTTGAACGG 0: 1
1: 0
2: 1
3: 12
4: 174
1185260845_1185260850 3 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260850 22:49862020-49862042 GGATTTTTGCCAGGATGGTAGGG 0: 1
1: 0
2: 0
3: 16
4: 409
1185260845_1185260848 -2 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260848 22:49862015-49862037 CATTTGGATTTTTGCCAGGATGG 0: 1
1: 0
2: 2
3: 16
4: 293
1185260845_1185260856 26 Left 1185260845 22:49861994-49862016 CCAACAGAGGGCATTACTAAGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1185260856 22:49862043-49862065 TGAGAAGGGGTATCTTGAACGGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185260845 Original CRISPR TGCTTAGTAATGCCCTCTGT TGG (reversed) Intronic
901254349 1:7808318-7808340 TTCTTTGTAATCCTCTCTGTTGG + Intronic
909672321 1:78203244-78203266 TGCTTTGCCTTGCCCTCTGTGGG - Intergenic
913081281 1:115389315-115389337 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
915471819 1:156130244-156130266 GGCTAAGTAAGGCCCTGTGTGGG + Intronic
918666517 1:187157642-187157664 TGGTTATTAATCCCCACTGTTGG + Intergenic
919436727 1:197572081-197572103 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
921004084 1:211075746-211075768 TGCTTCGGCTTGCCCTCTGTGGG - Intronic
921371313 1:214425538-214425560 TGCATAGTAAGGCGGTCTGTTGG - Intronic
1063173068 10:3526979-3527001 TTCTTAGAAATGACCTCTGTTGG - Intergenic
1065139407 10:22705776-22705798 TGCTTGGTTTTGCCCGCTGTCGG + Intronic
1065456272 10:25909849-25909871 TGCTTAGAAATCTCTTCTGTTGG - Intergenic
1067799939 10:49351914-49351936 TGATTAGTAATGGCATCAGTTGG - Intergenic
1068210062 10:53909671-53909693 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
1068950549 10:62772627-62772649 TGCTTTGTACTGACATCTGTGGG - Intergenic
1068951484 10:62782144-62782166 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1073160411 10:101388980-101389002 TGCTTTGAAATACCATCTGTGGG + Intronic
1073664259 10:105512053-105512075 TGCTTGGTAATTTCATCTGTAGG - Intergenic
1073998172 10:109339610-109339632 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
1075204189 10:120432439-120432461 TGCTTAGGAATGGCCTCTAGAGG + Intergenic
1077562145 11:3270752-3270774 TGCTTTGGCATACCCTCTGTGGG + Intergenic
1077568039 11:3316572-3316594 TGCTTTGGCATACCCTCTGTGGG + Intergenic
1077803780 11:5569421-5569443 TGCTTTGGTTTGCCCTCTGTGGG - Intronic
1079199276 11:18361309-18361331 TGGTTAGTCATGACCTCTGGAGG - Intronic
1086800889 11:91173838-91173860 TGCTTAGTATTTCTCACTGTAGG - Intergenic
1087257140 11:95968768-95968790 TGCATATGAATGCCCTCTGGTGG + Intergenic
1088212015 11:107466756-107466778 TGCTTAGGCTCGCCCTCTGTGGG + Intergenic
1088484783 11:110330039-110330061 TGCTTAGAAATTTCTTCTGTCGG + Intergenic
1092050023 12:5462109-5462131 TGATTAGTGATGCCTACTGTAGG - Intronic
1093402216 12:18760792-18760814 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1093694670 12:22146323-22146345 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
1093714407 12:22365758-22365780 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
1094061173 12:26316607-26316629 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1094837750 12:34330102-34330124 CACTTAGGAGTGCCCTCTGTGGG + Intergenic
1097402797 12:59150173-59150195 TGTGTATTACTGCCCTCTGTTGG + Intergenic
1097668957 12:62513644-62513666 TGCTTAGAAATGACTTCTGCCGG + Intronic
1097752902 12:63377922-63377944 TGCTTTGACTTGCCCTCTGTTGG - Intergenic
1100412530 12:94335679-94335701 TTCTTAATAATGCCTTTTGTTGG - Intronic
1101037863 12:100722631-100722653 CGGTGAGTAATCCCCTCTGTGGG + Intronic
1102458974 12:113088342-113088364 TGATTAGTAATGCCTGCTGTGGG + Intronic
1108674140 13:52721593-52721615 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
1110826261 13:79975069-79975091 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1112131141 13:96524834-96524856 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
1115645514 14:35366362-35366384 TGCTGTGTAATTTCCTCTGTGGG - Intergenic
1117716153 14:58583574-58583596 TGCTTGGGCTTGCCCTCTGTAGG + Intergenic
1117777810 14:59200268-59200290 AGCTCAGTAATGCTATCTGTGGG + Intronic
1119018568 14:71085144-71085166 TGCTTCGGCTTGCCCTCTGTGGG + Intronic
1127037487 15:54933842-54933864 TGGATTGTAATGCCCACTGTTGG - Intergenic
1127137965 15:55944152-55944174 TGCTTCGGCTTGCCCTCTGTGGG - Intronic
1127871873 15:63080611-63080633 TGCTTTGCAGTACCCTCTGTTGG + Intergenic
1129499245 15:76019645-76019667 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
1130432935 15:83867185-83867207 TTCTTAGTAATGCAGTCTTTTGG - Intronic
1132287985 15:100679536-100679558 TGCTTTGAGTTGCCCTCTGTGGG + Intergenic
1132994306 16:2815088-2815110 TGCTCAGTAAATCCCTCTCTTGG - Intergenic
1136619088 16:31416116-31416138 GGCTTAGTAATGCTCAATGTTGG + Intronic
1137678024 16:50313801-50313823 TGCTTAGTCATGCGCTCAGCTGG + Intronic
1142873112 17:2834117-2834139 TGGTCAGTAAAGCCCTCTGGAGG - Intronic
1145360133 17:22205034-22205056 TGCAGAGTAATGCCATCAGTGGG - Exonic
1147705028 17:42420502-42420524 TTCTTAGTTATTCCCTCTGTGGG + Intronic
1153135740 18:1915708-1915730 TGTTTAGTTGTCCCCTCTGTTGG - Intergenic
1155911080 18:31504879-31504901 TCCTTGGCAATGCCCTGTGTGGG - Intronic
1156443899 18:37219806-37219828 TGCTTCGGCTTGCCCTCTGTGGG + Intronic
1156462554 18:37329517-37329539 TGCTGAGTCATGGCCTCTTTTGG + Intronic
1157977074 18:52339972-52339994 TGCGCAGGGATGCCCTCTGTGGG - Intergenic
1160289472 18:77577894-77577916 TGCTTCGTCTTGCTCTCTGTGGG - Intergenic
1160942288 19:1626047-1626069 TGTTTTGTAAAGCCCTCGGTTGG + Intronic
925835321 2:7939682-7939704 TGTTTAGTAATAGCCTCTGTGGG - Intergenic
928053216 2:28023386-28023408 TGTTTAGCAATGCTCTCTGAAGG + Intronic
930840242 2:55837523-55837545 TGCTTTGCCTTGCCCTCTGTGGG + Intergenic
931494179 2:62783961-62783983 TGCTTAGAAATTTCCTCTGCTGG + Intronic
933464922 2:82639960-82639982 TGCTTAGAAATTCCTTCTGCTGG - Intergenic
934537316 2:95145894-95145916 TGTTTGGTAATGTCCTCTTTAGG + Intronic
936807816 2:116358570-116358592 TGCTTCGACTTGCCCTCTGTGGG - Intergenic
939224949 2:139353372-139353394 TGCTTAGAAATTTCTTCTGTTGG - Intergenic
939825252 2:147007712-147007734 TGTTTAGCAATTCCATCTGTGGG + Intergenic
940891669 2:159041762-159041784 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
942356557 2:175119431-175119453 TAGGAAGTAATGCCCTCTGTGGG - Intronic
942951993 2:181731788-181731810 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
945016787 2:205526827-205526849 TGTTTAGAAATGGCCTCTGGGGG + Intronic
945116804 2:206416051-206416073 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
947955330 2:234184939-234184961 TGCTTAGTTATGGCAGCTGTCGG + Intergenic
1169307140 20:4501804-4501826 TGCTTTGTCTCGCCCTCTGTGGG + Intergenic
1170303514 20:14912445-14912467 TCCTTAGTAATGACTTCTGAAGG - Intronic
1171798884 20:29590879-29590901 GGCTCAGAAATGCCCTTTGTAGG - Intergenic
1172848335 20:37943773-37943795 TGCTTAGTTATGTGGTCTGTTGG + Intronic
1173098890 20:40065223-40065245 TGCCTAGAAATGTCCTCTGGGGG - Intergenic
1173934441 20:46848856-46848878 TGATTAGTAATGCCTGCTATGGG - Intergenic
1175286873 20:57842463-57842485 TGCTTAAGAATGTCTTCTGTTGG - Intergenic
1177129589 21:17240311-17240333 TGCTTTGTCTTGCCCTCTGTGGG - Intergenic
1177393268 21:20502764-20502786 TGCTTAGAAATTTCTTCTGTTGG + Intergenic
1178640797 21:34343525-34343547 TGATTAGTAATGCCTGCAGTGGG + Intergenic
1181825907 22:25515527-25515549 TGCATGGAAATGCCCTCTGATGG + Intergenic
1185260845 22:49861994-49862016 TGCTTAGTAATGCCCTCTGTTGG - Intronic
952126735 3:30309581-30309603 TGCTCAGTAATGCCAGCTTTGGG - Intergenic
956166912 3:66404128-66404150 TGCTTAGGAATAAGCTCTGTTGG - Intronic
958547268 3:95570176-95570198 TGATTAGTAATTCACTATGTGGG - Intergenic
958553514 3:95645188-95645210 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
958843023 3:99231690-99231712 TGTTTTGTAATGCTCCCTGTAGG - Intergenic
960052379 3:113250978-113251000 TGCCTAGTAATGCCCAGTGATGG + Intronic
960177191 3:114531828-114531850 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
964010999 3:151891476-151891498 TGCTTTGTGATGCCTTCTGCCGG - Intergenic
965064533 3:163829524-163829546 TGGTGAGTAGTGCTCTCTGTGGG + Intergenic
966281689 3:178238408-178238430 TGCTGAATAATAACCTCTGTGGG - Intergenic
966607784 3:181838968-181838990 TCCATAGTAATTCCCTGTGTTGG + Intergenic
966743106 3:183252383-183252405 TGCTGAGCCATGCCCTGTGTAGG + Intronic
969909269 4:10428375-10428397 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
971673692 4:29595971-29595993 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
972219224 4:36935461-36935483 TGCTTTGGCTTGCCCTCTGTTGG - Intergenic
972748797 4:41968432-41968454 TGCTTAGTAATTTCTTCTGCTGG - Intergenic
972821972 4:42712151-42712173 TGCTTAGTAATGTCTTTAGTGGG + Intergenic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
974364772 4:60932446-60932468 AGCTTAGAAATGCAGTCTGTTGG - Intergenic
974792920 4:66713732-66713754 TGCTTCGGCTTGCCCTCTGTGGG - Intergenic
976451550 4:85196495-85196517 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
976467264 4:85384936-85384958 TGTTAACTAATGACCTCTGTAGG - Intergenic
977561435 4:98537292-98537314 TGCTTCGGCTTGCCCTCTGTGGG + Intronic
978066070 4:104404467-104404489 TTCTTAGAATTGCCATCTGTTGG + Intergenic
980156092 4:129108823-129108845 TGCTTAGAAATGACATCTTTGGG - Intronic
983958895 4:173728272-173728294 TCCTTTGTCTTGCCCTCTGTTGG + Intergenic
993266398 5:85732003-85732025 TGCTTTGGTTTGCCCTCTGTGGG - Intergenic
998388280 5:141771016-141771038 TGCTGAGTAGGGCCCTCTCTGGG + Intergenic
998640600 5:144006073-144006095 TGTTTAATAATCCCCTCTTTAGG + Intergenic
999425647 5:151485745-151485767 TGCTTAGCAGTGCTCTCTGCTGG + Intronic
1000017952 5:157294892-157294914 GGGTTAGTAATGCCCTCTGGAGG - Intronic
1000965342 5:167649084-167649106 AGCTTAATAATTCCCTCTTTAGG + Intronic
1002804372 6:558275-558297 TTCTTTATAATGCCCTCTGGTGG - Intronic
1004928047 6:20434812-20434834 TGCTTAGTACTGCCCATGGTGGG - Intronic
1005260339 6:24052255-24052277 TGCATAGTAATGCCCACTTTAGG - Intergenic
1006120054 6:31798637-31798659 GGCTTAGGAATGCCCCCTTTTGG - Intronic
1008720943 6:54350945-54350967 TGTTTAATGAAGCCCTCTGTAGG - Intronic
1010997711 6:82551981-82552003 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
1014568958 6:122986013-122986035 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1016241789 6:141939934-141939956 TGCTTTGTCTCGCCCTCTGTGGG - Intergenic
1017968795 6:159290838-159290860 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1018747335 6:166772703-166772725 GGCTTAGTAGCGCCATCTGTGGG - Intronic
1019820494 7:3239348-3239370 TGCTGAGAAATGCTCTCGGTTGG + Intergenic
1021066168 7:16175900-16175922 TGCTTAGTAATGTCATCAATAGG - Intronic
1021379940 7:19954679-19954701 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1022472653 7:30691238-30691260 CAGCTAGTAATGCCCTCTGTGGG + Intronic
1026895739 7:74009058-74009080 TCCTCAGGAATGCCCTCTGCAGG + Intergenic
1026967561 7:74450106-74450128 TGCTCAATACTGCCCTCTGCAGG - Intergenic
1027446165 7:78275248-78275270 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
1027733651 7:81906171-81906193 TGCTTAGTAGTGCAATCTGCTGG - Intergenic
1028236990 7:88373882-88373904 TGCTTTGGTTTGCCCTCTGTAGG + Intergenic
1028403889 7:90455613-90455635 TGACTACTAATGCCATCTGTTGG - Intronic
1030801257 7:113856112-113856134 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1030936703 7:115593956-115593978 TGCTTTGTCTAGCCCTCTGTGGG - Intergenic
1032250730 7:130255024-130255046 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1036401911 8:8416357-8416379 TGCTTAATAATGTCATCTGTGGG - Intergenic
1039180772 8:34863717-34863739 TGCTAAGTATTGGACTCTGTGGG + Intergenic
1040110725 8:43566195-43566217 TGCTTTGTTGTGCCCCCTGTGGG + Intergenic
1040531812 8:48272077-48272099 TGCTAAGTCATACCCTCTGTAGG - Intergenic
1040607303 8:48946636-48946658 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
1042070857 8:64931544-64931566 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1042931254 8:74016027-74016049 TGCTTTGGCTTGCCCTCTGTGGG - Intronic
1043756633 8:84011745-84011767 TGATTAGTAATTCCCTCAGGTGG - Intergenic
1045123361 8:99063235-99063257 TGCTTCGGCTTGCCCTCTGTGGG - Intronic
1045469463 8:102498349-102498371 TGCTTATTCATGTCCTCTGTGGG + Intergenic
1049123728 8:140766338-140766360 TGCATGGTAAAGCCCTCAGTTGG - Intronic
1052061626 9:23966952-23966974 TGCTTTGGCTTGCCCTCTGTGGG + Intergenic
1055239140 9:74163315-74163337 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1060702034 9:125763185-125763207 TTCTTTGAAATGCCCTTTGTGGG + Intronic
1186354155 X:8772966-8772988 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1188744958 X:33830132-33830154 TGCTTTTTATTGCTCTCTGTGGG + Intergenic
1189590563 X:42506865-42506887 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1189944129 X:46159898-46159920 TCCTTAGTAAAGCCCTGTTTTGG + Intergenic
1191096039 X:56673835-56673857 TGCTTTGGCTTGCCCTCTGTGGG - Intergenic
1191257637 X:58286523-58286545 TGCTTTGTGGTGCCTTCTGTGGG + Intergenic
1192316790 X:70058541-70058563 TGAATTGTAATACCCTCTGTTGG - Intergenic
1193419961 X:81271226-81271248 TGCTTTGGCTTGCCCTCTGTGGG + Intronic
1194624698 X:96214346-96214368 TGCTTCATCTTGCCCTCTGTGGG - Intergenic
1194963917 X:100266667-100266689 TGCTTCGGCTTGCCCTCTGTGGG - Intergenic
1195351276 X:103998717-103998739 TGCTTCGGCTTGCCCTCTGTGGG + Intergenic
1195755386 X:108194252-108194274 TGCTTAGAATTGCCAACTGTTGG - Intronic
1196900509 X:120378403-120378425 TGCTCAGTATGGCTCTCTGTTGG - Intronic
1198072011 X:133158897-133158919 TGCTTCGGCTTGCCCTCTGTGGG - Intergenic
1200892765 Y:8341224-8341246 TGTGTAGTAATTCCCTCTCTTGG - Intergenic