ID: 1185263844

View in Genome Browser
Species Human (GRCh38)
Location 22:49887015-49887037
Sequence GGGGCAGCCCAAAAATCTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185263844_1185263852 27 Left 1185263844 22:49887015-49887037 CCGTCAGATTTTTGGGCTGCCCC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1185263852 22:49887065-49887087 TTCAACACACCCACTGAGAACGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185263844 Original CRISPR GGGGCAGCCCAAAAATCTGA CGG (reversed) Exonic
902412459 1:16219411-16219433 GGGGTATCCCACAAACCTGAGGG + Intergenic
903333250 1:22608316-22608338 GGGGCAGCCCCAGAATCTGTGGG - Intergenic
905354647 1:37372887-37372909 GAGGAAGCCCAAGACTCTGAAGG + Intergenic
913529557 1:119724068-119724090 GGGGCAGCCTAGAAATCAAATGG + Intronic
916189808 1:162167649-162167671 GGGGCAGCCCTGCTATCTGAGGG + Intronic
917371372 1:174297815-174297837 AGGGCAGCTCAAAAATCCCAAGG + Intronic
921733665 1:218601716-218601738 TGGGCTGCCTAGAAATCTGATGG - Intergenic
1064859079 10:19805866-19805888 GAGGCAGAAAAAAAATCTGAGGG + Intergenic
1069757769 10:70783687-70783709 GTGGCAACCCAAATGTCTGATGG + Intronic
1070195310 10:74151299-74151321 GCCGAAGCCCAAAAAGCTGAAGG + Exonic
1077095969 11:799282-799304 GGGCCAGCCTAAAAGTCTGTGGG + Exonic
1078000425 11:7490340-7490362 GGGGCTTCCTAAAAAGCTGATGG + Intronic
1080426123 11:32155785-32155807 GGAGCAGCGGAATAATCTGAAGG + Intergenic
1080761239 11:35250976-35250998 GGGGTAGCCCTCAAATCTCAGGG - Intergenic
1091229395 11:133977917-133977939 GGGGCATCACAAAGATCTGTGGG - Intergenic
1091660822 12:2381941-2381963 GGGACAGCCCAACAATCAGAGGG + Intronic
1091738470 12:2942580-2942602 AGGGCAGCTTAAAAATGTGAAGG - Intergenic
1092456476 12:8648171-8648193 GGGGCAGACCAGCCATCTGACGG + Exonic
1096339542 12:50786051-50786073 GGGGCCACCCTAAAATCTGTTGG + Intronic
1096412218 12:51385488-51385510 AGGGCATCCCAAAAATCTTAGGG - Intronic
1101555961 12:105809845-105809867 AGGGGAGCCCAAATATCTAATGG - Intergenic
1101574950 12:105988590-105988612 GGGCCAGCTCCATAATCTGAAGG + Intergenic
1107449908 13:40498855-40498877 GGGGCAAGCCAGAATTCTGAAGG - Intergenic
1114334054 14:21669549-21669571 AGGGCTGCCCAGAAATCTGAAGG + Intergenic
1114400545 14:22406252-22406274 TGGACTGCCCAACAATCTGAGGG + Intergenic
1114605051 14:23989323-23989345 GGGGCAGCCCAGAACACTGGGGG - Intronic
1114610504 14:24036883-24036905 GGGGCAGCCCAGAACACTGGGGG - Intergenic
1114665544 14:24375409-24375431 GGGCCAGCCCAGAAACCAGAGGG - Intronic
1118612606 14:67553442-67553464 GGGGCAGCTCACAGAACTGAAGG + Intronic
1119086183 14:71741336-71741358 GATGCAGCCCAAAAATGTGCTGG - Intergenic
1119854081 14:77886345-77886367 GGGGCAGCCCCAGTATCTCAGGG - Intronic
1120210257 14:81627122-81627144 GGGGCAGCTCAAATACCTGGAGG - Intergenic
1121967901 14:98327277-98327299 GGGGCAGCTCAGAAAACAGAAGG + Intergenic
1122818642 14:104328507-104328529 GGGACAGAGCAAAAATCTCATGG - Intergenic
1122902067 14:104786101-104786123 GGGGCAGACCAAAAATGAGGTGG - Intronic
1123034850 14:105467693-105467715 GGGGCAGCCCCAATACCAGATGG - Intronic
1127296707 15:57614994-57615016 GAGGCAGCCCAAGGAGCTGATGG - Intronic
1128537271 15:68500705-68500727 TGGGCTGCCCAAAAATCCAAAGG - Intergenic
1130649033 15:85751692-85751714 GGGGTAGCCCACACATCTGTGGG - Intergenic
1131525768 15:93151213-93151235 GAGGCAGCCCTAAAATTTAAAGG - Intergenic
1132613086 16:827392-827414 GGGGCCGCCCAAGAATCAGGCGG - Intergenic
1132733540 16:1374771-1374793 GGGGCATCCCAAAAAACAGCTGG + Intronic
1135008405 16:18849600-18849622 AGGGCAGCTCAAAAATGTTACGG + Intronic
1137901817 16:52276885-52276907 GAGGCAGCCCCAAAACCTGGTGG + Intergenic
1138107864 16:54299877-54299899 GGGGCCACCCACAATTCTGAGGG + Intergenic
1138699674 16:58849095-58849117 GGTGCAACCCAGAAATGTGAGGG - Intergenic
1139255154 16:65534084-65534106 GGGGCTGCCAAAAATCCTGATGG + Intergenic
1145780857 17:27562168-27562190 TGGGCAGCCCAGAAATCCAAAGG - Intronic
1147457356 17:40546094-40546116 GGGGCAGCAGAACAATGTGAAGG - Intergenic
1149034604 17:52120155-52120177 AGGGCAGCTCAAAAATCCCAAGG - Intronic
1151994749 17:77601475-77601497 GGGGCAGCCCCAGAAGGTGAGGG - Intergenic
1157498453 18:48172675-48172697 GGGGCCGCCCAAGGAACTGAGGG - Intronic
1158726329 18:59976211-59976233 GGGGCAGGGAAAGAATCTGAAGG - Intergenic
1159922966 18:74242855-74242877 GTGTCAGCCCAAAAGACTGAGGG - Intergenic
1159925520 18:74265742-74265764 GGGGGAGCCCACACATCTCATGG + Intronic
925344818 2:3163743-3163765 GGGGGAGCCCAAGAACTTGAAGG + Intergenic
926496699 2:13597861-13597883 GGAGCAGGCCATAGATCTGAGGG + Intergenic
928370691 2:30738175-30738197 GGGGAAGCCCACAGAGCTGAGGG + Intronic
929873899 2:45780622-45780644 GGGGCACCCCAAACCTCTGTAGG + Intronic
935089298 2:99879032-99879054 TGGGCAGCCCAGGAATCTGCGGG + Intronic
936078014 2:109414077-109414099 GGGGCAGCCCAATAAACAGAAGG - Intronic
938584179 2:132672523-132672545 GGGCCTGCCAAAAAATCGGAGGG - Exonic
942209897 2:173659786-173659808 GGGCCAGCCCAGCAATGTGAGGG - Intergenic
943781021 2:191824178-191824200 GGGTCATCCCAAAAATGTGCAGG + Intergenic
944712174 2:202344363-202344385 AGTGCAGCCCAAACACCTGAGGG + Intergenic
948792714 2:240387551-240387573 GGAGCAGCCCAGAAATCTGAGGG - Intergenic
1169315176 20:4584560-4584582 GGGGCAGACCAGAAGTCTTAAGG + Intergenic
1170824646 20:19783420-19783442 GGGGACGCCCAAAAACCTGGGGG - Intergenic
1178202727 21:30426034-30426056 GAGGGAGCACAAAAATGTGAGGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183060475 22:35333553-35333575 AGGGCACCCCGAAAATCTGCAGG - Intronic
1185263844 22:49887015-49887037 GGGGCAGCCCAAAAATCTGACGG - Exonic
953469396 3:43154261-43154283 GAGGCAGCCCTGAAAACTGAAGG + Intergenic
961496634 3:127297684-127297706 AGGGAAGCTCAAAAATCAGATGG + Intergenic
966016442 3:175144678-175144700 AGGGCTGCCCAAAAATATGAAGG - Intronic
967257017 3:187603712-187603734 GGGGCAGCTAAAAACTCTCATGG - Intergenic
971370223 4:26013066-26013088 GGGTCAGCCCACCAATCTGGGGG - Intergenic
976422335 4:84860350-84860372 GGGGCACTACAAGAATCTGAAGG - Intronic
980121813 4:128735322-128735344 GGGGCAGCTCACAAAACTCAGGG + Intergenic
982077292 4:151750302-151750324 GAGACAGCTCAAAGATCTGAAGG - Intronic
982547854 4:156758217-156758239 GGGCCAGCACAGAAATTTGAGGG + Intergenic
984793800 4:183638915-183638937 GAGCCTGCCCAAAAATCTTAGGG - Intergenic
987006404 5:13714578-13714600 GGTGCAGCCCAAACACCTCAGGG + Exonic
988792088 5:34618061-34618083 GGAGCACCCCAAATACCTGAGGG + Intergenic
989057499 5:37379315-37379337 GGGACAGCCCAAACAACTGCAGG - Exonic
989666230 5:43857556-43857578 AAGGCAGCCCACAAATCTGAGGG + Intergenic
989715167 5:44454379-44454401 AGGACAGCTCAAAAATCTCAAGG + Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
992158873 5:73981338-73981360 GGTGCAGCCCAGAAATCTCTTGG - Intergenic
995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG + Intergenic
1001270206 5:170305464-170305486 GGGGCAACCCCAAAGTCTGCCGG - Intergenic
1002692203 5:181058357-181058379 AGAGCAGCCCAAAAATATGCAGG + Exonic
1006905249 6:37528882-37528904 GGGGCAGGCCAAAAGCCTGAGGG + Intergenic
1009562771 6:65270397-65270419 GGGGCTGCCCCAAACTGTGAGGG - Intronic
1011591177 6:88972118-88972140 AGGGCAGCTCAAAAATCCCAAGG - Intergenic
1013367201 6:109445384-109445406 GGGGGTTCCCAAAATTCTGATGG - Intronic
1022029859 7:26482306-26482328 GGAGTAGCACAAAAATTTGAGGG + Intergenic
1027556252 7:79668342-79668364 GGGGCAGCCCACATATCACATGG + Intergenic
1028380089 7:90190414-90190436 GGAGCTGACCAAAAAGCTGAAGG + Intronic
1036640187 8:10578555-10578577 TGGGCAGTCCAAGTATCTGATGG + Intergenic
1038957205 8:32480733-32480755 GGGGGAGCCCACATATCAGATGG + Intronic
1039868353 8:41525587-41525609 GGGACAGACCAAAAAATTGAGGG - Intergenic
1045781446 8:105868346-105868368 GAGGTAGCACAAAAATTTGATGG + Intergenic
1047599263 8:126409913-126409935 GGGGCAGACGCAAAATCTGTGGG + Intergenic
1049559560 8:143302399-143302421 AGGGCAGAGCCAAAATCTGAGGG - Intergenic
1049982296 9:915532-915554 GGGGCAGAGCAAAACTCGGAAGG - Intronic
1057291388 9:93809606-93809628 GGGGCAGCCCCCAAATGTAAGGG - Intergenic
1061770436 9:132915841-132915863 GGGGCAGCCCTGAAATCGAAAGG - Intronic
1186029575 X:5353299-5353321 AGGGCAGACCTTAAATCTGATGG - Intergenic
1186060910 X:5706034-5706056 GGTCCAGCCCAAAAGACTGAGGG - Intergenic
1188924595 X:36023845-36023867 GGGGGAGCCCACTACTCTGAAGG - Intergenic
1190707684 X:53044203-53044225 GTGGGAGCCCAAAAATGTCAGGG - Intergenic