ID: 1185266264

View in Genome Browser
Species Human (GRCh38)
Location 22:49905967-49905989
Sequence GGGCCTTGAGACAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185266264_1185266282 28 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266282 22:49906018-49906040 GCTCTTGCTCCCAGGGTGGCCGG 0: 1
1: 0
2: 1
3: 30
4: 500
1185266264_1185266279 21 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266279 22:49906011-49906033 ACGGCCTGCTCTTGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 149
1185266264_1185266283 29 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266283 22:49906019-49906041 CTCTTGCTCCCAGGGTGGCCGGG No data
1185266264_1185266278 20 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266278 22:49906010-49906032 AACGGCCTGCTCTTGCTCCCAGG 0: 1
1: 0
2: 3
3: 43
4: 253
1185266264_1185266280 24 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266280 22:49906014-49906036 GCCTGCTCTTGCTCCCAGGGTGG 0: 1
1: 0
2: 1
3: 36
4: 454
1185266264_1185266270 -5 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266270 22:49905985-49906007 GGCCCTGGGCCCTGACACCGTGG 0: 1
1: 1
2: 24
3: 29
4: 342
1185266264_1185266274 2 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266274 22:49905992-49906014 GGCCCTGACACCGTGGGAAACGG No data
1185266264_1185266271 -4 Left 1185266264 22:49905967-49905989 CCCCCAGGACTGTCTCAAGGCCC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 1185266271 22:49905986-49906008 GCCCTGGGCCCTGACACCGTGGG 0: 1
1: 0
2: 0
3: 27
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185266264 Original CRISPR GGGCCTTGAGACAGTCCTGG GGG (reversed) Intronic
900180801 1:1310165-1310187 GGCCCTCGGGACAGTGCTGGGGG - Intronic
900191262 1:1353286-1353308 GGGCCTGAAGACATTCCTGGAGG - Exonic
900401546 1:2474844-2474866 GGGCCTGGAGACAGACCAGACGG - Intronic
900534467 1:3170238-3170260 GGGCCTGCAGGCACTCCTGGGGG - Intronic
901038762 1:6351773-6351795 TGGCCTTGTGTCATTCCTGGGGG - Intronic
901084019 1:6599771-6599793 GGGCCTTGGGACAGTTCTCCTGG + Intronic
901680800 1:10911655-10911677 GGGCCCTGAGACTGCCCTGTGGG - Intergenic
901752332 1:11418164-11418186 CGGCAGTGAGACAGCCCTGGAGG - Intergenic
902254394 1:15178216-15178238 GAGCCAGGAGACAGTCCTGGTGG + Intronic
904405993 1:30288235-30288257 AGGCCTGGAAACAGCCCTGGCGG + Intergenic
904473510 1:30750195-30750217 GGGCCTTGTGTCATACCTGGAGG - Intronic
904624592 1:31795271-31795293 GTGCTTTGAGACTGTTCTGGAGG - Intronic
905631816 1:39523000-39523022 GGGCGATGACCCAGTCCTGGGGG - Exonic
906127868 1:43438680-43438702 GGACCTTGACACAGCCATGGTGG - Exonic
906182703 1:43835601-43835623 GGGCTGTGGGACAGTCCAGGGGG - Intronic
907425589 1:54377265-54377287 GGGCCTGGAGGCAGACCTTGTGG - Intronic
916937127 1:169640749-169640771 GAGCCTAGAGACAGCCATGGTGG + Intergenic
919770286 1:201154196-201154218 GGGCCTTGAGAAGGAACTGGAGG - Exonic
921061541 1:211589363-211589385 GGGTCTTGGGCCAGGCCTGGTGG + Intergenic
922865068 1:228852703-228852725 GGGCCTTCTGACAGTGCTTGGGG - Intergenic
1063196695 10:3750017-3750039 TGGCCCTGACACAGTCCTTGGGG + Intergenic
1065163755 10:22952681-22952703 GGGCCTTTATACAGTAGTGGTGG - Intronic
1065241387 10:23708606-23708628 AGGCCTTGAGGCAGTCCTTGCGG + Intronic
1065473153 10:26103802-26103824 GAACCTTCAGACAGTGCTGGTGG - Intronic
1070809305 10:79289618-79289640 GGGCACTGAGACAGGCCTGGGGG + Intronic
1071554701 10:86593161-86593183 GGCCCTTGGGACAGGCCTGCTGG + Intergenic
1072237521 10:93466129-93466151 GGGACTTGAGAGACACCTGGGGG + Intronic
1073322444 10:102623650-102623672 GAGCCTTGAGCCAGGCGTGGTGG + Intronic
1073909406 10:108323701-108323723 GGGCATTGAGACTTTCCTTGTGG - Intergenic
1075059009 10:119241640-119241662 AGGCCCTGAGACAGTCGGGGTGG + Intronic
1075544534 10:123344976-123344998 GGGCCCTAAGAAAGTCCTTGAGG - Intergenic
1076437494 10:130456093-130456115 TGGGCAAGAGACAGTCCTGGAGG + Intergenic
1076612526 10:131735675-131735697 GGACCTTGAGACTTACCTGGGGG + Intergenic
1076871195 10:133195935-133195957 GGACCTAGAAACAGACCTGGTGG - Intronic
1077205517 11:1341305-1341327 GGGCCATGGGACAGCCATGGGGG - Intergenic
1077391863 11:2303992-2304014 GGGCCGTGAGGGACTCCTGGGGG - Intronic
1077419195 11:2441640-2441662 GGCCCAGGAGACAGCCCTGGGGG + Intergenic
1082162776 11:48901950-48901972 GGGCTTGGAGAGCGTCCTGGAGG - Intergenic
1082657992 11:55874354-55874376 GGGCGTGGAGAACGTCCTGGAGG - Intergenic
1082982616 11:59137290-59137312 GCGCCTTGAGAGGGTCTTGGAGG + Intergenic
1084951086 11:72665803-72665825 GGGGTTTGGGGCAGTCCTGGAGG - Intronic
1085306340 11:75488173-75488195 TGGCCTTAATACAGTCCTGGTGG - Intronic
1086697930 11:89865366-89865388 GGGCGTGGAGAGCGTCCTGGAGG - Intergenic
1086708232 11:89979122-89979144 GGGCGTGGAGAGCGTCCTGGAGG + Intergenic
1096043729 12:48543603-48543625 AGTCCTGGAGACAGCCCTGGAGG - Intergenic
1096799695 12:54101956-54101978 GGGCTATAAGACAGTCCTTGTGG + Intergenic
1096978176 12:55712266-55712288 GGCCCTTGAGACAGTCCAAATGG - Intronic
1097068665 12:56338989-56339011 GCGCCTTGCACCAGTCCTGGTGG - Exonic
1098536985 12:71604189-71604211 TGGTCTTGAGACAGGCGTGGTGG - Intergenic
1100550251 12:95640350-95640372 AGGCCTTGAGAAAGACCTGGGGG - Intergenic
1101168264 12:102061780-102061802 GGCCCTTGTGACAGGCCTGTGGG - Intronic
1101333825 12:103778875-103778897 GAGCCTTGAGACAGTTAAGGGGG - Intronic
1102221398 12:111197326-111197348 TGGCATTGATCCAGTCCTGGGGG - Intronic
1104826104 12:131710775-131710797 GGGCCTTGGGCGAGTCCTCGTGG - Intergenic
1107992073 13:45827521-45827543 AGGCCTGGAGCCAGTCCAGGAGG + Intronic
1108357874 13:49643516-49643538 GGGCCTGGAAACAGGACTGGGGG + Intergenic
1112596788 13:100814870-100814892 GGACCTTGTGACAGATCTGGAGG - Intergenic
1113730435 13:112637500-112637522 GGGCCTGGAGGCCGCCCTGGCGG - Intergenic
1113904715 13:113813842-113813864 TGGCCTTGAACCAGTCCGGGAGG + Exonic
1115026823 14:28756338-28756360 GGGCGGGGAGACATTCCTGGAGG + Intergenic
1117627029 14:57650770-57650792 GGGCCATGAGGCTGACCTGGAGG - Intronic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1119280730 14:73405349-73405371 GGGCCTTGAGCCAGAGCTAGAGG - Intronic
1119665778 14:76484141-76484163 GGGCCTTGGGCCAGACATGGTGG - Intronic
1121410434 14:93745286-93745308 GAGCCCTGAGACCGTCCTGGTGG - Intronic
1121624305 14:95373302-95373324 GGGTCATGAGACAGTTGTGGTGG + Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122973110 14:105160146-105160168 GGGTGTGGACACAGTCCTGGGGG - Intronic
1122973143 14:105160238-105160260 GGGCGTGGACAGAGTCCTGGTGG - Intronic
1127206451 15:56725060-56725082 GGGGCTTGAGAGAGGCCTGGGGG - Intronic
1127632523 15:60840323-60840345 GGGCTCTGACACAGGCCTGGTGG + Intronic
1127730562 15:61798090-61798112 GGGCCCTGAGGCAGCTCTGGAGG + Intergenic
1128819401 15:70638351-70638373 GGGCCTTGGGACAGGGCTTGGGG + Intergenic
1130569394 15:85027131-85027153 AGGCCTTCAGGGAGTCCTGGAGG - Intronic
1130576381 15:85096712-85096734 GGGCCTTGGTACAGTTCTGAGGG - Intronic
1131524613 15:93143096-93143118 GGGCTGGGAGACAATCCTGGAGG - Intergenic
1132317800 15:100902639-100902661 CAGCCTTGAGCCAGTCCTGTGGG + Intronic
1132341455 15:101080877-101080899 GAGCCTGGTGACAGCCCTGGGGG - Intergenic
1132496655 16:266566-266588 TGGCCGTGGGACAGTCCTGCAGG - Intronic
1132924958 16:2424542-2424564 GGGGCCTGAGACAGGGCTGGGGG - Intergenic
1132925156 16:2425456-2425478 GGGCCTTGTCACAGTCCCGGAGG + Intergenic
1133100179 16:3474662-3474684 GGGCAGTGAGTGAGTCCTGGGGG + Intronic
1133731131 16:8579473-8579495 TGTCCTTGAGTCTGTCCTGGAGG + Intronic
1135645608 16:24159026-24159048 GAGCCTGGAGACAGGCCTGCAGG - Intronic
1136147440 16:28323612-28323634 GGCCAGTGGGACAGTCCTGGTGG + Exonic
1136546690 16:30958482-30958504 GGGGCTCGAGACGGGCCTGGGGG + Intronic
1142025430 16:87810404-87810426 GGGCCTGGGGACAGTCCTGCAGG - Intergenic
1142553652 17:756964-756986 CGGACTTCAGACAGTCCTGCAGG + Intergenic
1142865646 17:2789934-2789956 GGACCTTGAGATAGTGCAGGTGG + Intronic
1143509657 17:7388510-7388532 GGGCGTGGAGGCAGGCCTGGAGG - Exonic
1143682683 17:8489104-8489126 GGGCCTCCTGACTGTCCTGGAGG - Intronic
1143993716 17:10988920-10988942 GGGCCTTTAGAAAGTGCTGGGGG + Intergenic
1144890096 17:18489529-18489551 GGGCCTTGAGTGAGCCGTGGAGG - Intronic
1145005868 17:19337415-19337437 AGGCCTTGAGACGAGCCTGGAGG + Intergenic
1145142120 17:20454788-20454810 GGGCCTTGAGTGAGCCGTGGAGG + Intronic
1146003938 17:29149089-29149111 GGGCCTGGAGGCCGGCCTGGCGG - Intronic
1146272204 17:31491826-31491848 GGGCATTGAGGCATTTCTGGAGG + Intronic
1146883858 17:36457994-36458016 GGGCCTTGGGGCTGTCATGGGGG - Intergenic
1146916209 17:36680031-36680053 GGGCCTAGTGACAGTCCTACTGG - Intergenic
1151730518 17:75908523-75908545 GGGCCTAGTGCCAGTCATGGAGG - Intronic
1152661677 17:81545278-81545300 GGGACTTGAGAGTGTGCTGGAGG + Intronic
1152794828 17:82301770-82301792 GGGCCTTGAGACAGCACAGTGGG - Intergenic
1154139581 18:11811186-11811208 GGGCCGTGGGACGGTCCAGGAGG - Intronic
1157581256 18:48775540-48775562 GGGCCCTGGGACTGGCCTGGAGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160990276 19:1857577-1857599 GGGCCTGGAGACAGGACTGCGGG + Intronic
1161103453 19:2432555-2432577 GGGCGGTGTCACAGTCCTGGTGG - Intronic
1161299103 19:3534356-3534378 GTGCCTCGGGACAGTGCTGGGGG - Intronic
1161806314 19:6445088-6445110 GGGCCTTGTGCCAGGCATGGTGG - Intronic
1163245083 19:16088487-16088509 TGGCCGTGACACATTCCTGGCGG + Intronic
1163586428 19:18166832-18166854 GGTCCTTGAGAAAACCCTGGAGG + Intronic
1163695207 19:18760399-18760421 GGGCCTGGGTACAGGCCTGGTGG + Intronic
1165102304 19:33446180-33446202 GTGCCTGGAGATAGTGCTGGTGG - Intronic
1165726931 19:38119474-38119496 GGTCCTTGAGATACTCCTGGCGG - Exonic
1166391965 19:42413376-42413398 GGGCCTTGGGCCAGGCGTGGTGG + Intronic
1167247990 19:48385336-48385358 GGGTGATGTGACAGTCCTGGGGG - Intronic
1167298343 19:48664549-48664571 TGGCCTGCAGACAGGCCTGGGGG - Intronic
925769451 2:7267832-7267854 GGGCGTTGAGACCCTGCTGGGGG - Intergenic
928328286 2:30337346-30337368 GGGCCTGGAGACCGTTCTTGGGG - Intergenic
928987614 2:37196604-37196626 GGGCCTCGTCACAGTTCTGGGGG + Intronic
930550494 2:52828835-52828857 CATGCTTGAGACAGTCCTGGCGG + Intergenic
931668319 2:64625638-64625660 GGGCTTTGAGGCAGGTCTGGTGG - Intergenic
932050015 2:68389027-68389049 GGGCATGGACAGAGTCCTGGGGG + Intronic
932221004 2:69998977-69998999 TGGCCCAGAGACAGTCCTGTGGG - Intergenic
935681866 2:105645235-105645257 GGACCTTGAGACCATCCTGGTGG - Intergenic
936831627 2:116654436-116654458 GGGCCTTGAGACAATATAGGAGG + Intergenic
937264448 2:120607162-120607184 ACGCCTTGAGGCAGTCCGGGAGG + Intergenic
937808628 2:126174807-126174829 GGGCCTTGGGAGAGTCGGGGAGG + Intergenic
938771484 2:134504838-134504860 GGGCCATGATAGAGTCCTGGAGG + Intronic
946362200 2:219225722-219225744 TGGGCCTGAGACAGTCCTGTGGG - Intronic
947813880 2:233023145-233023167 CTGGCTTGAGACACTCCTGGAGG + Intergenic
948846265 2:240684147-240684169 GGTGCTGGAGTCAGTCCTGGGGG - Intergenic
1169674879 20:8142231-8142253 CAGCCTTGAGGCAGACCTGGAGG + Intronic
1172635093 20:36404987-36405009 GGGCCTTGCTGCAGACCTGGGGG + Intronic
1172700790 20:36852435-36852457 GAGCCTTGACAGACTCCTGGGGG - Intronic
1173833772 20:46111585-46111607 GGGCCTGGAGACAGTGCAGGGGG + Intergenic
1175241304 20:57551434-57551456 GGGCTTTGAGGAAGTCCAGGTGG + Intergenic
1176302040 21:5103018-5103040 GGCCTTAGAGACAGGCCTGGCGG + Intergenic
1178308381 21:31509388-31509410 GGCCCTTGAGTGGGTCCTGGGGG - Intronic
1179854989 21:44158882-44158904 GGCCTTAGAGACAGGCCTGGCGG - Intergenic
1179971518 21:44838583-44838605 GGGCCTGGGGACAGGCCTAGGGG - Intergenic
1180948610 22:19710263-19710285 GGGGCTGGAGACAGTGCTGCTGG + Intergenic
1182445334 22:30386627-30386649 GGGCCTTGGGATAGGCCTGCGGG + Exonic
1182659754 22:31916993-31917015 GGGCCTGGGGACAGCCCTGATGG + Intergenic
1184168364 22:42743790-42743812 GGGCCTTGGAACATCCCTGGAGG + Intergenic
1184431448 22:44443494-44443516 GGGCCTCAGGCCAGTCCTGGAGG + Intergenic
1184508636 22:44918957-44918979 GGAGGTTGGGACAGTCCTGGGGG - Intronic
1184857447 22:47154125-47154147 TGGCCTGGAGACAGTGCTGGAGG - Intronic
1185020270 22:48370456-48370478 AGGCCTTGAGTGGGTCCTGGAGG - Intergenic
1185266264 22:49905967-49905989 GGGCCTTGAGACAGTCCTGGGGG - Intronic
1185340474 22:50288659-50288681 GGCCCTTAGGACAGGCCTGGGGG - Intronic
950528587 3:13539404-13539426 GCGCCTTGAGGCAGTGCTGCAGG - Intergenic
950531713 3:13556125-13556147 GTGCCCTAAGACTGTCCTGGCGG + Intronic
950531879 3:13556924-13556946 GGGGCGTGAGGGAGTCCTGGTGG - Intronic
952681510 3:36098930-36098952 AGGACTTGAGTCAGTCCTGAAGG + Intergenic
953571470 3:44075109-44075131 GGGCATTGAGAGACTCCAGGAGG + Intergenic
954136351 3:48583872-48583894 GGGCCTTGAGGCTCTGCTGGGGG - Intronic
954370959 3:50169394-50169416 TGGCCATGAGAGAGTCCTGGAGG + Intronic
959532937 3:107454187-107454209 GGGCCCTGGGCCAGTCCTGTTGG - Intergenic
960145854 3:114201370-114201392 GGGCCTGGGGACAGTACTAGAGG - Intergenic
961051848 3:123753344-123753366 AGGCCTTGTGACAGTCCTATGGG + Intronic
961442791 3:126962703-126962725 GGGCCATGAGCCAGACATGGAGG - Intergenic
963063372 3:141242562-141242584 TGGACTGGAGACAGTGCTGGGGG + Intronic
968815773 4:2820926-2820948 GGACCCTGCTACAGTCCTGGGGG - Intronic
968875995 4:3268303-3268325 GGGCCCTGAGGCAGTCCTGAGGG + Intronic
968975996 4:3822310-3822332 GGGCCTTGAGCCAGGCCAGCTGG - Intergenic
969871843 4:10109598-10109620 ATGCCTTGAAACAGGCCTGGGGG + Intronic
971324688 4:25634249-25634271 GGACTTGGAGACAGTCCTGTGGG - Intergenic
971351763 4:25862420-25862442 GGGTCTAGAGAGAGTCCAGGAGG + Intronic
974689666 4:65280336-65280358 TGGCCTTGTGACAGCCCTGCAGG + Intergenic
981095019 4:140770205-140770227 GGGAGCTGAGACAATCCTGGTGG - Intergenic
985567836 5:629453-629475 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567893 5:629648-629670 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567916 5:629726-629748 GGGATTTGACTCAGTCCTGGTGG + Intronic
985567972 5:629921-629943 GGGATTTGACCCAGTCCTGGTGG + Intronic
985567992 5:629999-630021 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568002 5:630038-630060 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568022 5:630116-630138 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568081 5:630311-630333 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568115 5:630429-630451 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568138 5:630507-630529 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568185 5:630663-630685 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568218 5:630780-630802 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568241 5:630858-630880 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568274 5:630975-630997 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568330 5:631169-631191 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568363 5:631286-631308 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568386 5:631364-631386 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568624 5:632220-632242 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568644 5:632298-632320 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568654 5:632337-632359 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568674 5:632415-632437 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568721 5:632571-632593 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568754 5:632688-632710 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568777 5:632766-632788 GGGATTTGACCCAGTCCTGGTGG + Intronic
985568863 5:633078-633100 GGGATTTGACCCAGTCCTGGTGG + Intronic
986181140 5:5393886-5393908 GGGCCTTGGGAAAGACTTGGAGG - Intergenic
990654272 5:57937198-57937220 GGGCCTGGACACTGACCTGGAGG - Intergenic
996954291 5:129164486-129164508 GGGCCCTGAGAGAGGCCAGGAGG + Intergenic
997060950 5:130502106-130502128 TGGCCTTGAAACAGTCCTTAGGG + Intergenic
997195154 5:131974284-131974306 TGGCCCTGAGACAGGCCTTGTGG - Intronic
997600171 5:135133724-135133746 GGGCCCTGTGACAGTTCTGGTGG + Intronic
998162273 5:139820294-139820316 AGGTTTTGAGAAAGTCCTGGAGG + Intronic
998186305 5:139982383-139982405 GGGCCAGGACACAGTCCTGGCGG - Intronic
998480873 5:142461693-142461715 TAGCCTTCAGAAAGTCCTGGAGG - Intergenic
999311511 5:150554780-150554802 GGGCCTGGAGACAGTTCTGTGGG - Exonic
1001603059 5:172941533-172941555 GGCTCCTGAGACAGTGCTGGGGG - Intronic
1002642808 5:180638484-180638506 GGGCCCAGAGGCAGGCCTGGAGG - Intronic
1003312142 6:4978631-4978653 AAGCCTTGACACAGACCTGGTGG - Intergenic
1004923101 6:20395272-20395294 CGGTTTTGAGACAGACCTGGGGG - Intergenic
1004923108 6:20395297-20395319 CGGTTTTGAGACAGACCTGGAGG - Intergenic
1004923119 6:20395346-20395368 CGGTTTTGAGACAGACCTGGGGG - Intergenic
1005849477 6:29810646-29810668 CAGCCTTCAGAGAGTCCTGGAGG - Intergenic
1005861323 6:29904611-29904633 CTGCCTTCAGAGAGTCCTGGAGG - Intergenic
1006220267 6:32484115-32484137 GGGCCTGGAGGCGGTCCTGCTGG - Intergenic
1006681243 6:35798114-35798136 GGCCCTTGAGTCAGGCCTGCAGG - Intergenic
1008543604 6:52566574-52566596 TGGAGTTGAGACTGTCCTGGAGG - Intronic
1009021233 6:57949875-57949897 GGGCCTTGGGAAAGACTTGGAGG - Intergenic
1014747404 6:125216004-125216026 GGGTCAGCAGACAGTCCTGGGGG - Intronic
1018747872 6:166776346-166776368 TGACTTTGAGACCGTCCTGGGGG + Intronic
1018960163 6:168441881-168441903 TGGCCTTGGGACAGTCCGCGGGG - Intronic
1019470827 7:1219702-1219724 GGGCCTGGAGACACCCCTGGTGG + Intergenic
1019553285 7:1614625-1614647 GGGCCCTGGGAAGGTCCTGGCGG + Intergenic
1022539197 7:31120877-31120899 GGGGCTGTAGACAGTCCTGGGGG - Intergenic
1023985230 7:45089983-45090005 GAGCCTTGAGGCAGGTCTGGGGG - Intergenic
1028129571 7:87153259-87153281 GGGCGCGGGGACAGTCCTGGTGG + Intronic
1029422216 7:100477596-100477618 GGGCCCTGAGACAGGCCTGACGG + Exonic
1029445902 7:100612723-100612745 GGGCCTGGAGTCAGAGCTGGGGG - Exonic
1029518336 7:101042638-101042660 GGGCATTGACACAGACATGGTGG - Exonic
1030084983 7:105808155-105808177 GGGCCTGCAGGCAGCCCTGGTGG + Intronic
1033182180 7:139191077-139191099 ACCCCTTGAGACAGTCCTGAAGG - Exonic
1033904385 7:146183872-146183894 GAGCCTTGAGAGATTCCTCGAGG - Intronic
1033906997 7:146217723-146217745 GGGGATTGAGACTGACCTGGAGG + Intronic
1034551549 7:151823743-151823765 GGGCCCAGAGTCATTCCTGGTGG + Intronic
1037906601 8:22719204-22719226 GGGCCCTGAGGCTGCCCTGGAGG + Intronic
1038780571 8:30565850-30565872 GGGCCTTTGGACAGTCCTCCGGG + Intronic
1039805579 8:40994716-40994738 TGGCCCCGAGACAGCCCTGGTGG + Intergenic
1039835765 8:41255180-41255202 GAGCCTTGAGGAAGTCCAGGTGG + Intergenic
1040300650 8:46186285-46186307 TGCCCTCGGGACAGTCCTGGGGG + Intergenic
1040981904 8:53252569-53252591 GGTACTGGAGACAGGCCTGGGGG + Intergenic
1044525184 8:93242859-93242881 GGGCCCCAAGGCAGTCCTGGTGG - Intergenic
1044836698 8:96302429-96302451 GAGCCTTGAATCAGTCCTGAGGG + Intronic
1047726331 8:127687107-127687129 GGGGCTTGAAGCGGTCCTGGAGG - Intergenic
1049247280 8:141569599-141569621 TGGCCTTGGGACACTCCAGGTGG + Intergenic
1049288725 8:141790634-141790656 GGCCAATGAGACAGGCCTGGTGG + Intergenic
1049318006 8:141979873-141979895 GGTCCTTGCCACAGCCCTGGAGG - Intergenic
1049414676 8:142489813-142489835 AGGCCTGGTGTCAGTCCTGGCGG - Intronic
1049478121 8:142806296-142806318 GAGCCTTCTGAGAGTCCTGGAGG - Intergenic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1049708665 8:144054058-144054080 GGGTCTTGAGAGTGGCCTGGAGG - Intronic
1049782916 8:144436958-144436980 GGGCGAAGAGTCAGTCCTGGCGG - Intronic
1057210099 9:93196374-93196396 TGGCCATGTGACAGCCCTGGAGG + Intronic
1057897896 9:98924413-98924435 GGGGCTTGAGACAGGGATGGGGG - Intergenic
1060779756 9:126402702-126402724 GGGCCTTCAGACACTTCTGCAGG + Intronic
1061210301 9:129188037-129188059 GGGCCTTCAGCCAGGCATGGTGG - Intergenic
1061382969 9:130269517-130269539 GGCCCCTGAAACAGTTCTGGTGG - Intergenic
1061848380 9:133400702-133400724 AGGCCAGGAGACACTCCTGGTGG + Intronic
1185766034 X:2726665-2726687 GGGGTTAGAGACAGTCCTGCAGG + Intronic
1188749104 X:33884078-33884100 GCGCCTTGGGATAGACCTGGTGG + Intergenic
1190326649 X:49210727-49210749 GGGCCTTGAGAAAGGGCTAGTGG - Intronic
1190489231 X:50964573-50964595 GGCCCTCGAGACAGTACTAGAGG + Intergenic
1191851256 X:65587983-65588005 GGACCAGGAGACAGTCCGGGAGG - Intergenic
1196007506 X:110851858-110851880 GGGGCTTCAGACAGTTCTGTGGG - Intergenic
1196442376 X:115728506-115728528 GTGGCTTGGGACTGTCCTGGGGG - Intergenic
1196443181 X:115732398-115732420 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196443840 X:115735366-115735388 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196445502 X:115844313-115844335 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196446173 X:115847294-115847316 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196446844 X:115850275-115850297 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196447512 X:115853258-115853280 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196448183 X:115856237-115856259 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196448852 X:115859228-115859250 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196449523 X:115862219-115862241 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196450192 X:115865202-115865224 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196450862 X:115868187-115868209 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196451533 X:115871166-115871188 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196452204 X:115874153-115874175 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196452874 X:115877122-115877144 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196453544 X:115880115-115880137 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196454213 X:115883124-115883146 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196454880 X:115886113-115886135 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1196455293 X:115888195-115888217 GTGGCTTGGGACTGTCCTGGGGG + Intergenic
1199727939 X:150603484-150603506 GGGCCTTAATACAGTCATAGTGG + Intronic
1200141800 X:153906221-153906243 GGGCCATCAGAGAGGCCTGGGGG + Exonic
1201904696 Y:19076920-19076942 GGGCCTTGGGTCAGGCCTGGAGG - Intergenic