ID: 1185266925

View in Genome Browser
Species Human (GRCh38)
Location 22:49909129-49909151
Sequence CTTCTCTGCAGCGTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185266925_1185266936 30 Left 1185266925 22:49909129-49909151 CCTGCAGCCACGCTGCAGAGAAG 0: 1
1: 1
2: 4
3: 25
4: 248
Right 1185266936 22:49909182-49909204 GGCCCAGGAGATGTGGCTGCAGG 0: 1
1: 0
2: 5
3: 61
4: 450
1185266925_1185266929 6 Left 1185266925 22:49909129-49909151 CCTGCAGCCACGCTGCAGAGAAG 0: 1
1: 1
2: 4
3: 25
4: 248
Right 1185266929 22:49909158-49909180 GCAGCTGCTTCCACTGCCCATGG 0: 1
1: 0
2: 3
3: 33
4: 380
1185266925_1185266931 15 Left 1185266925 22:49909129-49909151 CCTGCAGCCACGCTGCAGAGAAG 0: 1
1: 1
2: 4
3: 25
4: 248
Right 1185266931 22:49909167-49909189 TCCACTGCCCATGGAGGCCCAGG 0: 1
1: 0
2: 0
3: 29
4: 299
1185266925_1185266935 23 Left 1185266925 22:49909129-49909151 CCTGCAGCCACGCTGCAGAGAAG 0: 1
1: 1
2: 4
3: 25
4: 248
Right 1185266935 22:49909175-49909197 CCATGGAGGCCCAGGAGATGTGG 0: 1
1: 0
2: 3
3: 40
4: 355
1185266925_1185266930 9 Left 1185266925 22:49909129-49909151 CCTGCAGCCACGCTGCAGAGAAG 0: 1
1: 1
2: 4
3: 25
4: 248
Right 1185266930 22:49909161-49909183 GCTGCTTCCACTGCCCATGGAGG 0: 1
1: 0
2: 2
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185266925 Original CRISPR CTTCTCTGCAGCGTGGCTGC AGG (reversed) Intronic
900543446 1:3215639-3215661 CTCCTCTGCACGGTGGCTCCAGG + Intronic
900951315 1:5859622-5859644 CGTCTCTGCTGCGAAGCTGCAGG - Intergenic
901917226 1:12509020-12509042 CATCTCAGCAGCGGGGCTTCAGG - Exonic
902470728 1:16646351-16646373 CTGCCCTGCAGAGTGGGTGCAGG - Intergenic
902723725 1:18321809-18321831 CAGCTCTGGAGCCTGGCTGCAGG + Intronic
903172874 1:21564389-21564411 TTTCTCTGCGGTGGGGCTGCGGG + Intronic
904423783 1:30410484-30410506 CTTCCCTGCAGAGTGGCCCCTGG - Intergenic
905063183 1:35157221-35157243 CTTCACTGCAGCCTGGGTGATGG - Intergenic
905929527 1:41777344-41777366 CATCTCTTCAGCCTGTCTGCAGG + Intronic
907393187 1:54171972-54171994 GTTCTGTGCAGCCTGGCTGCTGG - Intronic
909491839 1:76234997-76235019 CTTCTCTACAGAGTCGCTGGTGG + Intronic
912273806 1:108236015-108236037 CACCTCTGCAGCCTGGGTGCAGG - Intronic
912294413 1:108458308-108458330 CACCTCTGCAGCCTGGGTGCAGG + Intronic
912449529 1:109760632-109760654 CTTCTCTGTAGGGTGGAGGCTGG - Intronic
914755241 1:150558571-150558593 CCTCTCTGCTGGGGGGCTGCGGG - Exonic
915681539 1:157586359-157586381 CTTGTCTGCTCCGTGGCTGAAGG - Exonic
915713727 1:157925137-157925159 CTTGTCTGCTCCGTGGCTGAAGG + Intergenic
918022763 1:180711005-180711027 CTTCTCAGACGGGTGGCTGCCGG + Intronic
920985692 1:210886280-210886302 CTGCTCTGCTGCGGGTCTGCTGG - Intronic
921213125 1:212916610-212916632 CCTCTCTCCACCGTGGCTCCCGG + Intergenic
921445529 1:215242514-215242536 CTTCTGAGGAGCCTGGCTGCAGG - Intergenic
1063938794 10:11106896-11106918 CCTCTCTGCAGAAAGGCTGCTGG + Intronic
1065097733 10:22298369-22298391 CTTCTCTGAAGCATTGCTGTGGG + Intergenic
1066198555 10:33125164-33125186 ATCCTCTGCAGGGTGGCTGTGGG + Intergenic
1067685060 10:48461777-48461799 CTTCCCTGCAGGGTGGCTTGTGG + Intronic
1072248952 10:93566867-93566889 CATCTTTGCAGTGTCGCTGCTGG + Exonic
1072979514 10:100088105-100088127 CTTCTCTGCAGAGTTACTGCTGG - Intergenic
1075442979 10:122494199-122494221 CATCTCTGCAGCTGGACTGCGGG + Intronic
1075556671 10:123437812-123437834 CTTCTCTGCAGCATGGTGGCTGG + Intergenic
1075649714 10:124119488-124119510 CTGCTCTTCACCCTGGCTGCTGG + Intergenic
1075715156 10:124551445-124551467 CTGCTCTGCAGGGTGGGGGCGGG + Intronic
1075948274 10:126456158-126456180 CTTGTCTTCAGCCTGTCTGCTGG - Intronic
1077127093 11:945132-945154 CCTCTCTGCAGCGTGGCACACGG - Intronic
1078337050 11:10472965-10472987 CTGCTCTCCAGCCTGGCTGAGGG + Intronic
1080785653 11:35472949-35472971 CCTCTCTGCAGAGTGGCTGCAGG - Intronic
1081703050 11:45163966-45163988 CTTCCCTGCATGCTGGCTGCTGG - Intronic
1082562290 11:54632869-54632891 CTGCACTGCAGCCTGGCTGATGG - Intergenic
1082683867 11:56214223-56214245 CTCCTCTGAAGCATGGCTGAGGG + Intergenic
1085259399 11:75195702-75195724 CTCCTCTGCAGCCTGGCCACTGG + Intronic
1085784816 11:79440121-79440143 CTAGTCTGCAGAGGGGCTGCAGG + Intronic
1087968603 11:104451372-104451394 CTTTCCTGGAGTGTGGCTGCTGG + Intergenic
1089138769 11:116270059-116270081 TTTCTCTGGAGCAAGGCTGCAGG - Intergenic
1089388394 11:118083051-118083073 CTCCTCTGCTGCGCCGCTGCGGG + Intronic
1089465218 11:118680573-118680595 GTTCTCTGCAGCTAGGCTGAGGG - Intergenic
1090116167 11:123976851-123976873 CCTCACTGGAGCGAGGCTGCAGG + Exonic
1091311695 11:134579611-134579633 CATCTGTGCAGGGTGCCTGCAGG - Intergenic
1091565848 12:1647293-1647315 CTGCTCTGCAGTGTGGATGAGGG + Intergenic
1092995826 12:13949407-13949429 CTTCTCTCCAGGGTTGCTACAGG + Intronic
1093236849 12:16619874-16619896 CTTCTTTACAGCATGGCAGCTGG + Intergenic
1093978898 12:25453208-25453230 CCTCTCTGCAGGGCAGCTGCTGG - Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1097898694 12:64852742-64852764 CCTCTCTGCTGCATGTCTGCTGG + Intronic
1098237518 12:68431730-68431752 CTTCTCTGCAGAGTAGCTGTGGG + Intergenic
1098454981 12:70661871-70661893 CTTATCTGCAGCCTCACTGCTGG - Intronic
1098780269 12:74677270-74677292 CTTCTCTGCTGCAGGTCTGCAGG - Intergenic
1101197681 12:102402140-102402162 CCTCTCTGAATCTTGGCTGCTGG - Intronic
1101421119 12:104551921-104551943 CTTCTCTGCTGTCTGGGTGCTGG + Intronic
1101440797 12:104703078-104703100 CTTGCCTGCTGCGTGCCTGCTGG + Intronic
1101858118 12:108461073-108461095 CTTGGCTGCAGAGTGGGTGCTGG - Intergenic
1102569190 12:113817244-113817266 CTTCCCTGCTGCGTGGACGCAGG - Exonic
1103440185 12:120957233-120957255 CATCTCTGCAGAGTGACAGCAGG - Intergenic
1103478272 12:121234015-121234037 CAGCTCTGCCGCATGGCTGCAGG - Exonic
1104960325 12:132485556-132485578 CTTCTCTGCCCCGTGGAGGCTGG + Intergenic
1105356148 13:19661816-19661838 CTTCTCTGCAGCATGAATGAGGG - Exonic
1106983764 13:35321347-35321369 CTTCTCTGCTGTGGGTCTGCTGG + Intronic
1110181750 13:72625861-72625883 CTTCTCAGCAGGGAGGCTGGTGG + Intergenic
1111439273 13:88258159-88258181 CTACTCTCCAGCGTGACTTCTGG + Intergenic
1114342049 14:21754960-21754982 CTTCTCTGCTCCGGGTCTGCTGG - Intergenic
1114483897 14:23052002-23052024 CTTCTCTGGGGTGGGGCTGCTGG + Exonic
1115201133 14:30855583-30855605 CTTCCCTGCAGGGTTGCTGGGGG - Intergenic
1116402284 14:44522500-44522522 CTGCTCTCCAGCTTGGCTGATGG + Intergenic
1117180578 14:53187174-53187196 CCTCTTTGCAGCCTGCCTGCTGG - Intergenic
1117634761 14:57730060-57730082 CTGCACTGCATGGTGGCTGCTGG + Intronic
1118493117 14:66281106-66281128 CTTTTCTACTGCATGGCTGCTGG + Intergenic
1118647204 14:67851542-67851564 CCTCTCTGAAGGGTAGCTGCTGG + Intronic
1119623211 14:76148672-76148694 CTTCTCTGCAGCATTTCTGAGGG - Intergenic
1121279293 14:92687765-92687787 CGTCTCTGCCGCGAGCCTGCGGG - Intronic
1121423992 14:93835130-93835152 CTACTCTGCAGCTTTGCTGGAGG + Intergenic
1124460770 15:29889628-29889650 CATCTCTGCAGCCTGGCTGCTGG - Intronic
1124646562 15:31441188-31441210 CGTCTCTGGAGCGGGTCTGCAGG - Intergenic
1124957172 15:34367141-34367163 CTGCTCTGCAGAGTGGTGGCCGG - Exonic
1126644103 15:50857998-50858020 CTTCTCTCCAGAATGGCTGCAGG - Intergenic
1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG + Intronic
1127421795 15:58813457-58813479 CTTCTCTCCAGCCTGGGTGATGG + Intronic
1128151837 15:65368203-65368225 CTTCTCTCCAGAGTGCCTGCAGG - Intronic
1129115541 15:73363448-73363470 CTTCTCTGGAGCCTGGCAGTGGG - Intronic
1129272102 15:74424476-74424498 CTTCTTTGCAGGGTGGCTGGAGG - Intronic
1131515297 15:93072915-93072937 CTTCTCTGCAGCTTCCCCGCAGG - Exonic
1132465537 16:75782-75804 CTTCCCAGCAGGGTGGCTGCTGG - Intronic
1133280035 16:4659995-4660017 GGTCTCTGCGGCCTGGCTGCAGG - Intronic
1134248971 16:12561206-12561228 CTTCTGTACTGCATGGCTGCGGG - Intronic
1134690401 16:16187443-16187465 CTTGTCTGCAGAATGGCAGCTGG - Intronic
1135847543 16:25932275-25932297 CGGCACTGCAGCCTGGCTGCAGG + Intronic
1136072364 16:27795505-27795527 TTTCTCTGCAGGGTGCCTGCTGG - Intronic
1136477909 16:30524859-30524881 CTTCTCCCGGGCGTGGCTGCGGG + Exonic
1136958006 16:34806220-34806242 GCTTTCTGCCGCGTGGCTGCTGG + Intergenic
1139466064 16:67154862-67154884 GCTCACTGCAGCGAGGCTGCCGG - Exonic
1139580446 16:67870304-67870326 GTTTTCTGCAGTTTGGCTGCAGG + Intronic
1140515824 16:75540613-75540635 CTTCTCTGCAGTGTTGGTGTTGG + Intronic
1141453164 16:84119276-84119298 GATCTCTGCAGAGTGGCTGCTGG - Intergenic
1142509340 17:384781-384803 ATCCTCTGCAGCCTGGCTGCTGG - Intronic
1143009453 17:3857864-3857886 CCTCTCTGCCTCGGGGCTGCCGG - Intergenic
1143183262 17:4997133-4997155 CTTCCCTCCAGCGGGGCTCCAGG - Intronic
1144016703 17:11203045-11203067 CTGCTCTGCAGTGTGGCAGCTGG + Intergenic
1144434026 17:15223362-15223384 CTTCTCTGCTGCAGGTCTGCTGG + Intergenic
1144460991 17:15458504-15458526 CTACTCAGTAGCGGGGCTGCTGG + Intronic
1145121369 17:20263167-20263189 GTCCTCGGCAGCGTGGCTGATGG - Intronic
1145203014 17:20963695-20963717 GTCCTCGGCAGCGTGGCTGACGG - Intergenic
1145397201 17:22505687-22505709 CTGCTCTGCAGTGAAGCTGCAGG - Intergenic
1145884232 17:28371589-28371611 CTCCTCCGGGGCGTGGCTGCAGG + Intronic
1146950456 17:36901729-36901751 CTCTTCTGCAGCGAGGCTGGTGG + Intergenic
1147583430 17:41639184-41639206 CTGCCCTGCAGCCTGGCTGAGGG + Intergenic
1147853210 17:43458464-43458486 CACCTTTGCAGGGTGGCTGCTGG + Intergenic
1147978228 17:44259917-44259939 CAGCTCTCCAGCGTGGCTGCAGG + Exonic
1148745998 17:49918766-49918788 CAGCTCTGCAGTGTGGCTGGAGG - Intergenic
1151146869 17:72049382-72049404 CTTCTCTGCTGTGTTGGTGCTGG - Intergenic
1153258766 18:3200050-3200072 CTTAACTGCTGTGTGGCTGCAGG - Intronic
1153290139 18:3492966-3492988 CTTCTCTGCAGCCTGGCCGCTGG - Intergenic
1154028023 18:10725720-10725742 CTTCTCTCCACAGTGGCGGCAGG + Intronic
1154059540 18:11046814-11046836 CTTCTCTATAGCCTGGCTGCCGG - Intronic
1155331872 18:24727174-24727196 TTTCTCTGCATCCTGGCAGCAGG + Intergenic
1155882252 18:31163748-31163770 CTTCTCAGCAGCATGGGTGTTGG - Intergenic
1156384559 18:36593787-36593809 CTTATTTGCACTGTGGCTGCAGG - Intronic
1160810903 19:1012562-1012584 CTGCCCTGCAGTGTGGCCGCAGG - Exonic
1160871090 19:1278382-1278404 TTGCGCTGCAGTGTGGCTGCTGG + Intronic
1161067749 19:2247016-2247038 CTTCAAGGTAGCGTGGCTGCGGG + Exonic
1161122127 19:2534503-2534525 CTTCTCTGATGCATGGCTCCAGG + Intronic
1161541247 19:4852584-4852606 CTTCTCAGCTGTGTGGCTTCAGG + Intronic
1162393567 19:10403853-10403875 CGTCACTGCGGCGTGGCTGAGGG - Intronic
1163212169 19:15849170-15849192 TTTCTCTGCAGCAAGGATGCAGG + Intergenic
1163362918 19:16859291-16859313 CTTCTGGGCACAGTGGCTGCTGG + Intronic
1163431200 19:17268823-17268845 CTCCTCTTCAGTGGGGCTGCTGG - Exonic
1163603847 19:18263802-18263824 CTTCCTTGCAGCGTGGGTGGTGG - Intronic
1163843890 19:19628097-19628119 CTTGTCTGCGGCGTGACTGGAGG - Exonic
1166869721 19:45864103-45864125 GGTATCTGCAGCGTCGCTGCGGG + Intronic
1167232505 19:48293917-48293939 CTCCTCTGAGGCGTGGCTCCTGG - Intergenic
1168294967 19:55373838-55373860 CGTCCCCGCAGTGTGGCTGCAGG + Intergenic
925026011 2:607842-607864 CTCCTGTGCAGGGAGGCTGCAGG + Intergenic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
925740886 2:7005294-7005316 CTGCTCTGCAGGCTGGCTCCTGG + Intronic
927814195 2:26199792-26199814 CTTCTTTGTAGCGTGGCTGCAGG - Intronic
927981719 2:27378654-27378676 CTTCTCGCCAGTGTGGGTGCGGG + Exonic
929918773 2:46157512-46157534 CTTCTTTGCAGGGTGGGTGGGGG - Intronic
930166352 2:48207217-48207239 CTTCTGTTCAGCGTGGAGGCAGG + Intergenic
930234244 2:48873720-48873742 CTTCACTGCAGCCCAGCTGCTGG - Intergenic
932202648 2:69845421-69845443 CTGCTCTGCAGCTTGGGTGGTGG - Intronic
933758555 2:85659585-85659607 CTTCTTTTCAGCCTGGCAGCTGG + Intronic
933760891 2:85671181-85671203 TTCCTGTGAAGCGTGGCTGCAGG + Intergenic
935014647 2:99169124-99169146 CTTCTCTGTTACTTGGCTGCGGG - Intronic
937001787 2:118474416-118474438 CCTCTCTGCAGGGTTGCTACAGG - Intergenic
937028693 2:118720373-118720395 CATCTGTGCAGCGTGCCTGTGGG - Intergenic
937868785 2:126772942-126772964 CTCCTCTGCTGGGTCGCTGCGGG + Intergenic
938237377 2:129717316-129717338 ATCGTGTGCAGCGTGGCTGCAGG - Intergenic
940204021 2:151182762-151182784 CTTCTCTGGAGAGTGGATTCAGG - Intergenic
940637169 2:156312163-156312185 CTTCTCAGCAGCCTGACAGCAGG + Intergenic
942129575 2:172865076-172865098 CTGCTCAGCAGCCTGGCTGGAGG - Intronic
943539309 2:189192094-189192116 CTTCTCTGCTGTGTTGATGCAGG - Intergenic
946823947 2:223657243-223657265 CATCTCTGCAGTGTGTGTGCAGG - Intergenic
947333782 2:229058402-229058424 GTACTCTGCAGCATGGATGCTGG + Intronic
948323778 2:237094354-237094376 CTTGACTGCAGGGTGCCTGCTGG - Intronic
948727441 2:239943809-239943831 CAGCTCTGCAGAGGGGCTGCAGG - Intronic
1168732250 20:94928-94950 CTTATTTGTAGCCTGGCTGCTGG + Intronic
1169204667 20:3732926-3732948 CCTCTCTGCAGCGTGGCTGCGGG + Intronic
1170113467 20:12830519-12830541 CTTCTCTTCAGTGTGGCTCTGGG - Intergenic
1170782848 20:19441036-19441058 CTTGTCTGAAACATGGCTGCAGG - Intronic
1172448299 20:35004425-35004447 CTTCCCTGCTGTGTGTCTGCCGG + Intronic
1173269893 20:41524086-41524108 CTTCTCTGAAGCATTGTTGCTGG - Intronic
1173333550 20:42095436-42095458 CTACCCTGCAGCCTGGGTGCAGG + Intronic
1173597784 20:44270752-44270774 TTTCTTTACAGCATGGCTGCTGG + Intronic
1173758641 20:45540225-45540247 CATTTCTGCAGGGTGGCAGCAGG + Intronic
1174564685 20:51456493-51456515 CTTTTCTGCAGCCTGGCTTCTGG - Intronic
1174579666 20:51562707-51562729 CTTCTCTACCGCGTGCCCGCGGG + Intronic
1174713684 20:52733737-52733759 CTGCTCTCCAGCCTGGGTGCGGG + Intergenic
1178911404 21:36676739-36676761 CTTCTCTGCAGGGTGATTGGAGG - Intergenic
1179562613 21:42225675-42225697 CATCTCTGCAGAGTAACTGCTGG - Exonic
1182024725 22:27109038-27109060 CTTCTCTGGCGCGGGGCTGAGGG - Intergenic
1182053545 22:27331631-27331653 CTTCCCTGCAGAGTTGCTGCGGG - Intergenic
1185179011 22:49348686-49348708 CTCCCCTGCATGGTGGCTGCAGG - Intergenic
1185266925 22:49909129-49909151 CTTCTCTGCAGCGTGGCTGCAGG - Intronic
1185419538 22:50727864-50727886 AGCCTCTTCAGCGTGGCTGCTGG + Intergenic
950896248 3:16454315-16454337 CTTCTCAGCAAAGTGGCAGCTGG + Intronic
953404202 3:42652579-42652601 CCTTTCTGCAGCTTGACTGCTGG + Intergenic
954487044 3:50862647-50862669 CCTGGCTGCAGTGTGGCTGCAGG + Intronic
955250746 3:57279659-57279681 CTGCACTCCAGCCTGGCTGCAGG + Intronic
956189312 3:66593475-66593497 CTTTACTGCAGACTGGCTGCTGG - Intergenic
959025755 3:101237603-101237625 CTTCTCTGCTGCAGGTCTGCTGG - Intronic
960042501 3:113164923-113164945 CTTCCCTGTAGAGTGGCTGATGG - Intergenic
961756792 3:129132586-129132608 CTTCCCAGCAGAGTGTCTGCAGG + Intronic
962399191 3:135042555-135042577 CTCCTCAGCAGGGTGGTTGCTGG - Intronic
962444446 3:135452236-135452258 CTTCTCTGCTGTCTGACTGCAGG + Intergenic
962488600 3:135868674-135868696 CTTCTCTAGAGAGTGCCTGCAGG - Intergenic
965324851 3:167290440-167290462 CTCCTCTGCTGCATGTCTGCTGG - Intronic
968274725 3:197431658-197431680 CTTCCCCATAGCGTGGCTGCTGG - Intergenic
968615075 4:1574031-1574053 CTGGTGTGCAGTGTGGCTGCTGG - Intergenic
968676898 4:1887224-1887246 CTTCCTTGCAGCGTGGTGGCTGG + Intronic
971246518 4:24934048-24934070 CTTCTTTGCAGCATGACAGCTGG + Intronic
973544507 4:51966977-51966999 TTTCTCTGCAGAGTGGCTCAAGG - Intergenic
973844308 4:54894899-54894921 CTACTCTGCTCTGTGGCTGCTGG + Intergenic
976202720 4:82595874-82595896 CTGCTCAGCAGTGTTGCTGCTGG + Intergenic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
984577906 4:181472760-181472782 CTGCTCTGCAGCCAGCCTGCCGG + Intergenic
985199943 4:187474470-187474492 CTTCACTGCACCCTGGCTGTCGG + Intergenic
986626031 5:9724733-9724755 CTTCTCTGGTGTGTGGCTTCAGG + Intergenic
987237447 5:15957299-15957321 CAGCCCTGCAGGGTGGCTGCTGG - Intergenic
989825431 5:45848657-45848679 CCTCTCTGCTGCATGTCTGCTGG - Intergenic
991459994 5:66847782-66847804 CTACTCTCCAGCCTGGGTGCTGG + Intronic
993014966 5:82525073-82525095 CTTCTCTGCAGAGTAACTCCTGG + Intergenic
993503911 5:88689676-88689698 CTCATCTGCCGCGGGGCTGCCGG + Intergenic
994903684 5:105808010-105808032 ATTGACTGCAGCGTGGCTGAGGG - Intergenic
997721420 5:136080862-136080884 CTCCTCAGCAGCCTGGCTGCTGG - Intergenic
997879552 5:137577307-137577329 CTTCACTCCAGTGTGTCTGCAGG - Intronic
1004204543 6:13580060-13580082 CTGCTCACCAGAGTGGCTGCTGG + Intronic
1005143638 6:22662869-22662891 CTTCTCTGCAGGGTGGATTAAGG + Intergenic
1006794842 6:36725356-36725378 CTACACTGCAGAGTGGCTGGAGG - Intronic
1006896331 6:37473448-37473470 TTTCTCTGACTCGTGGCTGCAGG + Exonic
1006924756 6:37648254-37648276 CTTCTCTGGAACGTTGTTGCGGG - Intronic
1008252522 6:49257785-49257807 CTTCTATGCAGATTAGCTGCTGG - Intergenic
1009512345 6:64568866-64568888 CTCCTCTGCTGCATGTCTGCTGG - Intronic
1010665847 6:78629334-78629356 CTTCTCTGCAGAGCTGCTGCTGG + Intergenic
1010987631 6:82443212-82443234 AGTCTCTGCAGCCAGGCTGCAGG - Intergenic
1011198073 6:84802978-84803000 CTGCTCTGCAGCCTGGAGGCTGG + Intergenic
1011851346 6:91633145-91633167 CTTCTCTACAGAGTGGCTCCTGG + Intergenic
1014069874 6:117168762-117168784 GTTCTCTGCAGCCAGGCTGCAGG + Intergenic
1014113481 6:117646466-117646488 CTTCTCTGCTGCAGGTCTGCTGG - Intergenic
1014613360 6:123570998-123571020 CTCCCCTGCAGCCTGGCTTCTGG - Exonic
1015934746 6:138397374-138397396 GTTCCCTTCAGCGTGGCTGTTGG + Intergenic
1017628239 6:156369967-156369989 CTGCTCTGCAGCATAGCTGGGGG - Intergenic
1018472117 6:164106473-164106495 CTGCCCTGCATCGGGGCTGCGGG + Intergenic
1018956271 6:168412560-168412582 CCTCTCTGCCCCGTGGCGGCTGG + Intergenic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1023861524 7:44220060-44220082 CTTCACTGCAGCGGGGCCACAGG + Exonic
1026285071 7:68955606-68955628 CTTCCTTGCAGCGAGCCTGCAGG - Intergenic
1026476960 7:70744593-70744615 CTTCAGTGCCGCCTGGCTGCCGG + Intronic
1027189863 7:75990259-75990281 CTTCTCTGCAGTGTTGCAGGTGG - Intronic
1029137846 7:98387288-98387310 CTTTTCTCCAGCGTGGTTTCTGG + Intronic
1029677552 7:102080761-102080783 CCTCTCTGCACCGAGGCTGTTGG + Intronic
1030477531 7:110055540-110055562 TTTCTCTGCAGCGGGGCTTGAGG - Intergenic
1032800928 7:135316838-135316860 CTTCCCTGGAGCATGGCTGCCGG - Intergenic
1034260255 7:149751046-149751068 CCTCTCTGAAGCCTGACTGCTGG + Intergenic
1035286706 7:157811426-157811448 CTCCTCTCCATCGTGGCTGTTGG + Intronic
1035468445 7:159094621-159094643 CTTCTTTGCAGGGTGGCATCCGG + Intronic
1035601453 8:899364-899386 CTTCTCAGCAGCGTGGCCCAGGG - Intergenic
1035700073 8:1631673-1631695 CTTCCCTGCAGGGTGGCTTCAGG + Intronic
1037667060 8:20978882-20978904 CATCTCTGCACCCTGGCTCCCGG - Intergenic
1037744369 8:21631068-21631090 CTTCTCAGCAGCCTGGCGGGAGG + Intergenic
1038038337 8:23704770-23704792 TTGCTCTGCAGCCTGGCTGAAGG - Intronic
1039800076 8:40946463-40946485 CCTCTCTTCAGCCTGGCAGCTGG - Intergenic
1040538290 8:48328947-48328969 CTTCTTTGCAGCTGGGCTTCTGG - Intergenic
1042855426 8:73261872-73261894 CTTCCCTGCAGCAAGGCTCCAGG + Intergenic
1045167375 8:99621868-99621890 CTGCACTGCAGCCTGGGTGCTGG - Intronic
1045736352 8:105300279-105300301 CTTCTCTTTAGCGTAGCTACAGG - Intronic
1047423745 8:124727770-124727792 CTTCCCTGCAGTGTGGCCACCGG - Intronic
1047506038 8:125481252-125481274 CTTCTTTGCAGTGTGATTGCAGG + Intergenic
1047711053 8:127552902-127552924 CTTCTTTCCAGCCTGGCTCCAGG - Intergenic
1049472402 8:142782369-142782391 CTTCACGGCAGGCTGGCTGCAGG - Intergenic
1049519458 8:143080637-143080659 CTTCTCTCCTGCCGGGCTGCAGG - Exonic
1056066401 9:82939989-82940011 CTTCTCTACTGTGTAGCTGCCGG - Intergenic
1056595720 9:88006587-88006609 CCTCTTTGCAGTGTGGCTGTGGG - Intergenic
1056678381 9:88696210-88696232 CTTCTCTGTAGCTGGGCTGGTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058870971 9:109201411-109201433 CTCCACTGCAGCCTGGGTGCTGG + Intronic
1060121654 9:120996689-120996711 AGTCTCTGGAGCGAGGCTGCTGG - Intronic
1062089273 9:134666391-134666413 CTTCTCTGGAGAGTGGCTTTTGG + Intronic
1185718955 X:2366632-2366654 CTGCTCTTCAGCCTGGCTGATGG - Intronic
1186641656 X:11462001-11462023 CTTCTCTGCAAGTTGGCAGCTGG - Intronic
1187047002 X:15656613-15656635 CTTCTCTCCAGTGTGGCAGGTGG - Intronic
1189216728 X:39331560-39331582 CTTCTCAGCAGCGTTGGAGCAGG + Intergenic
1189754236 X:44254004-44254026 CTTCTCTGCTGCAGGTCTGCTGG - Intronic
1190688804 X:52897022-52897044 CTTCTCTGAAGCGTGGCTTGTGG - Intronic
1190697179 X:52958770-52958792 CTTCTCTGAAGCGTGGCTTGTGG + Intronic
1192739240 X:73876976-73876998 CTCCTTTGCATTGTGGCTGCAGG - Intergenic
1194206774 X:91019564-91019586 CTTCTCCACACTGTGGCTGCAGG + Intergenic
1199814603 X:151386613-151386635 CTTCTCTGTAGGGAGGGTGCTGG - Intergenic
1200062402 X:153489392-153489414 CTCCTCTTCGGGGTGGCTGCTGG + Intronic
1200123229 X:153800997-153801019 CTTCCCTGCAGCGGGACTCCAGG + Intergenic
1200374913 X:155769461-155769483 CTACTTTGCTGCGTGGCTGTAGG - Intronic
1200552523 Y:4594353-4594375 CTTCTCCACACTGTGGCTGCAGG + Intergenic