ID: 1185268835

View in Genome Browser
Species Human (GRCh38)
Location 22:49918989-49919011
Sequence GGACCCCGGATCCAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185268835_1185268841 -5 Left 1185268835 22:49918989-49919011 CCCTCACCCTGGATCCGGGGTCC 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1185268841 22:49919007-49919029 GGTCCCCCTCACCCTGGATTCGG 0: 1
1: 0
2: 3
3: 4
4: 101
1185268835_1185268842 -4 Left 1185268835 22:49918989-49919011 CCCTCACCCTGGATCCGGGGTCC 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1185268842 22:49919008-49919030 GTCCCCCTCACCCTGGATTCGGG 0: 1
1: 0
2: 2
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185268835 Original CRISPR GGACCCCGGATCCAGGGTGA GGG (reversed) Intronic
900086388 1:899858-899880 GCACCCCGGCTGCAGGGAGATGG + Intergenic
900367796 1:2318322-2318344 AGACCCAGAAGCCAGGGTGAAGG + Intergenic
900989282 1:6090593-6090615 GGAGGCCGGGTCCAGGGTGGGGG + Intronic
901081627 1:6587066-6587088 GGACCCCTGATCTGGTGTGAAGG - Intronic
901846274 1:11984694-11984716 GGACCCTGTATCCTGGGGGAAGG + Intronic
902263902 1:15247497-15247519 GGAGCCTGGATCCAGGAGGATGG - Intronic
902709099 1:18226565-18226587 GGACCCAGCCTCCAGGGTGAGGG - Intronic
903970243 1:27114114-27114136 GTAGCCCGCATCCAGGATGATGG + Exonic
904785004 1:32976109-32976131 GGGCCCCGGGTCCAGAGGGATGG - Intergenic
905252625 1:36659321-36659343 GGACCCAGGGTACAGGGTAAAGG - Intergenic
905389469 1:37626874-37626896 GGACCCCAGATCAGGGGTGAGGG + Intronic
906251444 1:44313780-44313802 GGCCCACGTATGCAGGGTGAAGG - Intronic
916936511 1:169633420-169633442 GGCTCCAGGATCCAGGGTGTGGG - Intergenic
922737883 1:227999148-227999170 AGACCCATGATCCTGGGTGATGG + Intergenic
1067449213 10:46371069-46371091 TGCCCCCGAGTCCAGGGTGAGGG - Intronic
1067588157 10:47489696-47489718 TGCCCCCGAGTCCAGGGTGAGGG + Intronic
1067878145 10:50021946-50021968 TGCCCCCGAGTCCAGGGTGAGGG - Intergenic
1069519588 10:69108069-69108091 GGACCAGGGATCCAGGGATATGG + Intergenic
1069836543 10:71312806-71312828 CCACCCAGGATCCAGGGGGAGGG - Intergenic
1070560959 10:77566243-77566265 GGACCAAGGATCCTGGGGGATGG - Intronic
1070586771 10:77772482-77772504 GGACCTCACATCCAGGGTAAGGG + Intergenic
1071994635 10:91135720-91135742 GGACCTGGGATACATGGTGAAGG - Intergenic
1074187233 10:111107720-111107742 GGACACAGGATCCAAGTTGAAGG - Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077610728 11:3641974-3641996 GGATCCCGGGTCCAGGATTAGGG + Exonic
1079098018 11:17523336-17523358 GGCCCCAGGCTCCAGGGTGGTGG + Intronic
1081612433 11:44570632-44570654 GCAACCTGGATCCAGGGAGATGG + Intronic
1082958085 11:58893167-58893189 GGACCCAGGATACAGGCTGCTGG - Intronic
1083294139 11:61706247-61706269 GGAGCCCAGCTCAAGGGTGAAGG - Intronic
1084506899 11:69574159-69574181 GGACCCCTGATCCAGGCAGGTGG - Intergenic
1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG + Intronic
1085116147 11:73933954-73933976 GGACACAGGATCCAGCTTGAAGG - Intergenic
1089579673 11:119473602-119473624 GGATCCGAGATCCAGGGTGAGGG + Intergenic
1091687454 12:2573602-2573624 GGACCATGGGTCCTGGGTGAGGG - Intronic
1100648722 12:96561092-96561114 GAACACAGGATCCAGTGTGAAGG - Intronic
1102594470 12:113981941-113981963 GGAACCCAGATGCAGGGAGAGGG + Intergenic
1107749580 13:43550237-43550259 GGACCCCTGCTCTAGGGTGCAGG + Intronic
1113647600 13:112010177-112010199 GGCCACCGGATCCAGGATGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1122127117 14:99585379-99585401 GGACCCCAGAGCCAGAGTGTAGG + Intronic
1125721660 15:41847968-41847990 GGTCCCAGGGTCCAGGCTGAGGG + Exonic
1127403005 15:58610432-58610454 GGATCCAGGTTGCAGGGTGATGG + Exonic
1128146360 15:65334443-65334465 GGTCCCCGAGGCCAGGGTGAGGG + Intronic
1128735201 15:70049730-70049752 GCACCCCCGACCCAAGGTGAGGG + Exonic
1129389768 15:75214693-75214715 GGACCCCTTTTCCAGGGTGGCGG + Intergenic
1129707791 15:77804655-77804677 TGACCCCGGCTCCAGGCTGGAGG + Intronic
1130403611 15:83579362-83579384 GACCCCAGGATCCAGGCTGAGGG - Intronic
1132062980 15:98707940-98707962 GGACACCGCATCCAGGATCAGGG - Exonic
1132897620 16:2236489-2236511 GGATCCCGGGTCCAGGCTGCGGG - Exonic
1133253388 16:4500248-4500270 GGGACCCCCATCCAGGGTGATGG + Intronic
1134092335 16:11398293-11398315 GGACCAGGGACCCATGGTGAGGG - Intronic
1138497380 16:57416573-57416595 AGACCCCAGCTCCAGGGCGAGGG + Intergenic
1140457530 16:75113866-75113888 GAACTCTGGATCCAGGGAGATGG + Exonic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1142171004 16:88622778-88622800 GGAGCCCGGCTCCCGAGTGAGGG + Intronic
1142749321 17:1977939-1977961 GGATGCAGGATCCAGGGTGCAGG - Intronic
1145812625 17:27773635-27773657 GGACCTCACATGCAGGGTGACGG - Intronic
1146840887 17:36153389-36153411 GGAACCCAGAGCCAGGGAGATGG - Intergenic
1152282903 17:79395921-79395943 GTACCCCAGACCAAGGGTGAGGG - Intronic
1152477396 17:80527028-80527050 GGACCCTTGATCCTGTGTGAGGG + Intergenic
1152623668 17:81378871-81378893 GGACGCCCCATCCTGGGTGAGGG - Intergenic
1159104831 18:63994070-63994092 GGACCCAGGAGCCAAGGGGAGGG - Intronic
1159931119 18:74314374-74314396 TGTCCCAGGATCCAGTGTGAGGG + Intergenic
1160437914 18:78865953-78865975 AGAGGCCGGGTCCAGGGTGAAGG + Intergenic
1160478809 18:79219264-79219286 GGGAGCCGGGTCCAGGGTGAGGG + Intronic
1160488186 18:79312455-79312477 GGACCCCTGGTCTGGGGTGAGGG - Intronic
1161223832 19:3133128-3133150 GGGCCCTGGATCCAGGGAGCCGG + Intergenic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1162412871 19:10517199-10517221 GGACCTGGGATACGGGGTGAAGG - Intronic
1162766639 19:12923959-12923981 GGACCCCAGATTCAGAGGGAGGG + Intronic
1166156118 19:40912501-40912523 GGGCCCTGGATCCAGGGAGCTGG + Intergenic
1166909009 19:46137682-46137704 GGTCCCCGGCTTCAGGGAGAGGG + Intergenic
1168154489 19:54465257-54465279 GGGCCCCAGATCCAGGTGGAAGG + Exonic
924962522 2:46741-46763 GGACCCCGGACGCGAGGTGAGGG - Intronic
925129973 2:1487932-1487954 GGACGCCAGATCCAAGGTGCTGG - Exonic
925141261 2:1551091-1551113 GGACGCCGGGGCCAGGGTGAGGG + Intergenic
925999785 2:9321441-9321463 GGACCAGGGATCCTGGGTGGGGG - Intronic
933813528 2:86048196-86048218 GGGCCCAGGAGGCAGGGTGAGGG + Intronic
937206660 2:120241009-120241031 GGACCCCAGATCCACTGTCACGG + Intronic
942051532 2:172145420-172145442 GGACCCCATAGCCAGGCTGAGGG + Intergenic
945283289 2:208057768-208057790 TGAACCCGGATTCAGGATGACGG + Intergenic
948453744 2:238094507-238094529 GGACCCCGGCTTCAAGGTGATGG + Exonic
948500576 2:238390219-238390241 AGACACTGGATCCATGGTGAGGG + Intronic
1171020900 20:21583215-21583237 GGTCCCTGGTGCCAGGGTGATGG + Intergenic
1172268886 20:33641345-33641367 GGACCCAGGATCCAGGGCCCAGG + Intronic
1174421393 20:50401267-50401289 GGGCACCGGATCCTGTGTGAAGG + Intergenic
1174507002 20:51023294-51023316 GGCCCCCGGATCCAAGGTGCGGG - Intergenic
1175404344 20:58716996-58717018 GGACACAGGATGCAGGGTCAGGG + Intronic
1175419739 20:58823639-58823661 AGAGCCCACATCCAGGGTGATGG - Intergenic
1175923762 20:62462183-62462205 GCACCCCAGACCCTGGGTGAGGG - Intergenic
1175944770 20:62553592-62553614 GGACCCCGTATCCATGAGGAAGG - Exonic
1176004404 20:62852383-62852405 GGACCCCAGTTCCAGGGTTCTGG - Intronic
1176517479 21:7796807-7796829 GGATCCTGGGTCCAGCGTGAAGG - Intergenic
1178651507 21:34426819-34426841 GGATCCTGGGTCCAGCGTGAAGG - Intergenic
1178753535 21:35326378-35326400 AGACCCAGGACCCAGGGTCAAGG + Intronic
1178949411 21:36974118-36974140 GGACCCTGGATCCCGGGCGACGG - Intronic
1179607753 21:42528454-42528476 GGTCCCTGGAGCCAGGGGGATGG + Intronic
1182331603 22:29555011-29555033 GGAGACAGGATACAGGGTGAGGG + Exonic
1183538595 22:38417087-38417109 GGAGCCCGCAGCCTGGGTGAGGG - Intergenic
1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG + Intronic
1184517769 22:44973229-44973251 GGACCCAGGGTCCAGGGACAGGG - Intronic
1184909979 22:47525247-47525269 GGACCCAGGACTCAGGATGATGG + Intergenic
1185268816 22:49918944-49918966 CGACCCCGGATGCAGGGTGAGGG - Intronic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
1185268845 22:49919012-49919034 GGATCCCGAATCCAGGGTGAGGG - Intronic
1185268851 22:49919035-49919057 GGACTCTGGATCGACGGTGAGGG - Intronic
1185343171 22:50300465-50300487 GGACTCCGGACCCAGGGTCAAGG + Intronic
1185412961 22:50695525-50695547 GGACCCAGGCCTCAGGGTGAGGG - Intergenic
953056953 3:39395721-39395743 GGATCCTGGATCCAGGCTGAAGG - Intronic
964255123 3:154766843-154766865 GGCCTCCTGATCCAGGGTGCAGG - Intergenic
966919600 3:184603004-184603026 TGACTCCGGATCCTGGGTGTGGG + Intronic
968292267 3:197547855-197547877 GGACTCAGCATCCAGGATGAGGG - Intronic
969576292 4:8037986-8038008 GGAGCCCAGAGCCAGGGAGAAGG - Intronic
969609437 4:8218832-8218854 GGACCCGGCATCCAAGGAGAAGG - Intronic
972571277 4:40312547-40312569 GGACACAGGAGCCAGTGTGAAGG + Intergenic
975949667 4:79754438-79754460 GGACTCAGGACCCAGGCTGAAGG - Intergenic
986724120 5:10581439-10581461 GGCTCCCGGATCCAGGGTAGAGG - Intronic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
993299220 5:86185708-86185730 GGAAGCTGGATCCAGGTTGAGGG + Intergenic
996529163 5:124509716-124509738 GGGCCCTCTATCCAGGGTGAGGG - Intergenic
1002319557 5:178366830-178366852 GGACCCTGCTTCCTGGGTGAAGG - Intronic
1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG + Intergenic
1003137473 6:3444779-3444801 GAAGCCTGCATCCAGGGTGATGG - Intronic
1003871336 6:10405097-10405119 GGACCACGGGTTCAGGGTGCAGG + Intronic
1007222108 6:40286874-40286896 GGACCCGGGCTTCAGGCTGAGGG + Intergenic
1007835156 6:44668349-44668371 GGACGCTGGAGGCAGGGTGAGGG - Intergenic
1012062861 6:94511043-94511065 GGACCTCGGACCCACGGTGGAGG - Intergenic
1018866660 6:167751742-167751764 GGTGCCCAGATCCAGGGAGATGG + Intergenic
1018935204 6:168269556-168269578 GGACCCCAGATCCAGGGACACGG + Intergenic
1024200867 7:47104227-47104249 AGACCCCGCATCCAGGGAAAGGG + Intergenic
1028098056 7:86786751-86786773 GGAGGCCAGCTCCAGGGTGATGG - Exonic
1033589596 7:142798118-142798140 GATCCCTGGGTCCAGGGTGAGGG + Intergenic
1035717327 8:1764048-1764070 GGACCGGGGATCCCAGGTGAGGG + Intronic
1036611880 8:10357536-10357558 GGACCCCAGAGCCAATGTGAAGG - Intronic
1045468361 8:102489494-102489516 TGACACCTGACCCAGGGTGAGGG - Intergenic
1049844601 8:144793663-144793685 GGACCCTGGGGGCAGGGTGAGGG + Intergenic
1053537414 9:38939179-38939201 GGTCGCTTGATCCAGGGTGAGGG - Intergenic
1054628721 9:67424751-67424773 GGTCGCTTGATCCAGGGTGAGGG + Intergenic
1056960159 9:91116476-91116498 GGAGCCTGGCTTCAGGGTGAAGG - Intergenic
1057863089 9:98657582-98657604 AGAACCAGGATCCAGGGTGAGGG + Intronic
1059694998 9:116722529-116722551 GGACACCAGAGCTAGGGTGAAGG + Intronic
1060301218 9:122375634-122375656 GGAACCCGGAGCCAGGGCAAGGG + Intronic
1062149158 9:135008626-135008648 GGATCCAGGATCCAGGGAGCAGG + Intergenic
1203780338 EBV:97006-97028 GGACCCCGGGGTCAGGGTGATGG + Intergenic
1189465696 X:41276264-41276286 GGTCCCCGGCTGCGGGGTGAGGG + Intergenic
1190581112 X:51893824-51893846 GGATTCAGAATCCAGGGTGAAGG - Intronic
1198339640 X:135701423-135701445 GGAACCAGGATTCAGGGTGAGGG - Intergenic
1200014201 X:153146804-153146826 GGGCCCCACTTCCAGGGTGATGG + Intergenic
1200025399 X:153253148-153253170 GGGCCCCACTTCCAGGGTGATGG - Intergenic
1201731587 Y:17210556-17210578 GGGCCCTGGATCCAGGCTTAAGG - Intergenic