ID: 1185268883

View in Genome Browser
Species Human (GRCh38)
Location 22:49919121-49919143
Sequence GGTCGACGCCACCGTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185268861_1185268883 28 Left 1185268861 22:49919070-49919092 CCTGGAGTCCCCCTCACCCTTGA 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268867_1185268883 12 Left 1185268867 22:49919086-49919108 CCCTTGACCCGGATCCACCCCCA 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268864_1185268883 19 Left 1185268864 22:49919079-49919101 CCCCTCACCCTTGACCCGGATCC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268873_1185268883 -2 Left 1185268873 22:49919100-49919122 CCACCCCCACCGTGGAACCAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268866_1185268883 17 Left 1185268866 22:49919081-49919103 CCTCACCCTTGACCCGGATCCAC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268876_1185268883 -6 Left 1185268876 22:49919104-49919126 CCCCACCGTGGAACCAGGGTCGA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268863_1185268883 20 Left 1185268863 22:49919078-49919100 CCCCCTCACCCTTGACCCGGATC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268870_1185268883 5 Left 1185268870 22:49919093-49919115 CCCGGATCCACCCCCACCGTGGA 0: 1
1: 0
2: 0
3: 6
4: 149
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268865_1185268883 18 Left 1185268865 22:49919080-49919102 CCCTCACCCTTGACCCGGATCCA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268878_1185268883 -8 Left 1185268878 22:49919106-49919128 CCACCGTGGAACCAGGGTCGACG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268877_1185268883 -7 Left 1185268877 22:49919105-49919127 CCCACCGTGGAACCAGGGTCGAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268875_1185268883 -5 Left 1185268875 22:49919103-49919125 CCCCCACCGTGGAACCAGGGTCG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268868_1185268883 11 Left 1185268868 22:49919087-49919109 CCTTGACCCGGATCCACCCCCAC 0: 1
1: 0
2: 1
3: 13
4: 190
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1185268871_1185268883 4 Left 1185268871 22:49919094-49919116 CCGGATCCACCCCCACCGTGGAA 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185268883 Original CRISPR GGTCGACGCCACCGTGGGCC TGG Intronic
900020939 1:186425-186447 GGTCGACCCCTCCGGTGGCCGGG - Intergenic
900158161 1:1211803-1211825 GGTTGCCGCCATCCTGGGCCTGG - Exonic
901844076 1:11971173-11971195 GGTCGAGGCCAGTGTGGGGCAGG + Intronic
902607981 1:17579893-17579915 GGGCGGTGCCACCTTGGGCCAGG + Intronic
902871747 1:19317779-19317801 GGACGAGGCCAGCGTGGGCCTGG + Exonic
906122573 1:43404136-43404158 GGTCGAGGCTACAGTGAGCCGGG + Intronic
907344590 1:53764365-53764387 GGTCAAGGCTACAGTGGGCCAGG + Intergenic
917969927 1:180199891-180199913 GGGCAGCGCCACCTTGGGCCAGG + Exonic
923713349 1:236404455-236404477 CATGGGCGCCACCGTGGGCCTGG + Intronic
1069708832 10:70476380-70476402 GATCTGCCCCACCGTGGGCCTGG - Intergenic
1076126452 10:127977977-127977999 GGTCCAGGCCTCTGTGGGCCAGG + Intronic
1077210910 11:1370540-1370562 GGTCGAAGCCAACGTGGGCTGGG + Intergenic
1077394180 11:2313088-2313110 GGACGAGGCCACTGTGGGGCAGG - Intronic
1079626787 11:22625711-22625733 GGACCCCGCCACCGTGCGCCGGG - Exonic
1084113612 11:67029008-67029030 GGTCAAGGGCACCGAGGGCCAGG - Intronic
1085047512 11:73362258-73362280 GGTGGGCGGCACCGCGGGCCTGG + Intronic
1097085461 12:56464905-56464927 GGTCGAGGCTACAGTGAGCCTGG - Intronic
1102329127 12:112013969-112013991 GGTCGACGCCACCGGGCTCCCGG + Intronic
1103933215 12:124461347-124461369 GGTGGACGCCACGGTGAGCGGGG - Intronic
1104192836 12:126499705-126499727 GGTCGAGGCTACGGTGAGCCAGG + Intergenic
1115910888 14:38255563-38255585 GCTCGACCCCACCGGTGGCCTGG + Exonic
1122363289 14:101180064-101180086 GGTCGAAGCCAGTGTGGGTCAGG - Intergenic
1130110085 15:80956884-80956906 GGTCGAGGCCACAGTGAGCTAGG - Intronic
1132893131 16:2214348-2214370 GGGCGTCGCCAGCGTGGGCGTGG - Exonic
1134518731 16:14907879-14907901 GATCGTCCCCACCGTGGGGCAGG - Intronic
1134555197 16:15158337-15158359 GATCGTCCCCACCGTGGGGCAGG + Intergenic
1134706402 16:16306532-16306554 GATCGTCCCCACCGTGGGGCAGG - Intergenic
1134743081 16:16565517-16565539 GGGTGACACCACTGTGGGCCTGG + Intergenic
1134924479 16:18146943-18146965 GGGTGACACCACTGTGGGCCTGG - Intergenic
1134961138 16:18405578-18405600 GATCGTCCCCACCGTGGGGCAGG + Intergenic
1134965440 16:18488181-18488203 GATCGTCCCCACCGTGGGGCAGG + Intronic
1135415731 16:22266801-22266823 GCTGGAGGCCATCGTGGGCCTGG + Exonic
1136778917 16:32885381-32885403 GGGCGACGGCCCCGCGGGCCTGG - Intergenic
1136891701 16:33976137-33976159 GGGCGACGGCCCCGCGGGCCTGG + Intergenic
1142114825 16:88351188-88351210 TGGCTACGCCACCGAGGGCCGGG - Intergenic
1203081329 16_KI270728v1_random:1147470-1147492 GGGCGACGGCCCCGCGGGCCTGG - Intergenic
1144530562 17:16034787-16034809 GGCAGACGCCAGGGTGGGCCTGG - Exonic
1148077553 17:44947599-44947621 GGTCGGTTCCGCCGTGGGCCAGG + Intronic
1150252551 17:63715521-63715543 GTTCGAGGCCACGGTGAGCCAGG - Intronic
1151854401 17:76710784-76710806 GGCCGAGGCCACCGGGGCCCCGG - Exonic
1152382780 17:79950796-79950818 GGGCGGCGGCACAGTGGGCCGGG - Intronic
1154502019 18:15001824-15001846 GGTCGACTCCTCCGTGTCCCTGG + Intergenic
1158718246 18:59899789-59899811 GGTCGGCGCCGCCGCGGGTCGGG + Intergenic
1158729896 18:60011135-60011157 GCTCGACATCGCCGTGGGCCAGG + Intergenic
1160978979 19:1807787-1807809 GGTCCAGGCCAGCGTGGGGCCGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1167570149 19:50281764-50281786 GGACGACGCCACCATGGACCTGG + Exonic
1167601810 19:50459118-50459140 GGTCCACACCACCTGGGGCCGGG - Exonic
925492702 2:4412752-4412774 GGTTGACGCCTCTGCGGGCCAGG - Intergenic
926581332 2:14634486-14634508 GGGCGCGGCCAACGTGGGCCGGG + Exonic
928432687 2:31234042-31234064 CGTCGCCGCAACCGTGGGGCCGG + Intergenic
935173730 2:100629878-100629900 GCTCGAGGCCACAGTGAGCCAGG - Intergenic
936568499 2:113597508-113597530 GGTCGACCCCTCCGGTGGCCGGG + Intergenic
941104909 2:161341164-161341186 GGCCGAGGCCACCGGGGCCCCGG - Intronic
941819265 2:169828073-169828095 GGGCGAGGCGACCCTGGGCCGGG + Intronic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
1175901701 20:62362405-62362427 GGTCAACGTCACCCTGGACCTGG - Exonic
1180616215 22:17129612-17129634 GGTCGAGGCTGCCGTGAGCCAGG + Intronic
1184676072 22:46044231-46044253 GGCTGAGGGCACCGTGGGCCTGG + Intergenic
1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG + Intronic
961236963 3:125375348-125375370 GGTCGCCGCCACTGCCGGCCCGG + Exonic
961827406 3:129606348-129606370 GGCCGAGGCGGCCGTGGGCCCGG - Exonic
964348310 3:155777507-155777529 GGTCGAGGCTACAGTGAGCCAGG - Intronic
969357846 4:6641117-6641139 GGGCGACGCGGCCGAGGGCCGGG + Exonic
972502252 4:39689317-39689339 GGTCTAGGCCACAGTGAGCCAGG - Intergenic
985260068 4:188106703-188106725 GGGCGAGGCCACCCTGGACCAGG + Intronic
985924387 5:3004567-3004589 TGTCTACGGCACCCTGGGCCTGG + Intergenic
986302872 5:6492074-6492096 TGTCTACGCCACCGTCTGCCAGG - Exonic
992400149 5:76403925-76403947 GGTCGCCGCCGGCTTGGGCCAGG + Intronic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
997869853 5:137497967-137497989 GGTCCACGCCACCGCTGCCCCGG + Intronic
999011769 5:148049781-148049803 GGTCGAGGCTACAGTGAGCCAGG - Intronic
1001492535 5:172165614-172165636 GGTTGACCTCACCCTGGGCCGGG + Intronic
1001826736 5:174751388-174751410 GGCCGCCGCCTCCGTGCGCCTGG - Intergenic
1011692847 6:89886215-89886237 GGTGGACGCCACCCTGGAACTGG + Intergenic
1017137506 6:151161308-151161330 GGAAGAAGCCACCATGGGCCAGG + Intergenic
1018612767 6:165661169-165661191 TGGCCACGCCACAGTGGGCCCGG + Intronic
1028867375 7:95729349-95729371 GGTCGAAGCTACAGTGAGCCAGG + Intergenic
1035102867 7:156415874-156415896 GGTCCTCGACACCGTGGCCCTGG + Intergenic
1038610923 8:29059747-29059769 GGGCGATGCCACAGTGCGCCTGG - Intronic
1052321321 9:27170554-27170576 GGTCGAGGCTGCAGTGGGCCAGG + Intronic
1052947148 9:34177752-34177774 GGTCGAGGCTACAGTGAGCCAGG - Intergenic
1057228518 9:93304931-93304953 CGTGGAGGCCTCCGTGGGCCAGG + Intronic
1057306560 9:93915830-93915852 GCTCGACGACACTATGGGCCTGG - Intergenic
1062306926 9:135912716-135912738 GGTCGAGGCTACAGTGAGCCGGG + Intergenic
1190305309 X:49078630-49078652 GGTCCACGTCAGTGTGGGCCTGG - Intronic
1192508757 X:71708986-71709008 GGTCGAGGCTACAGTGAGCCGGG + Intergenic
1192517940 X:71772567-71772589 GGTCGAGGCTACAGTGAGCCGGG - Intergenic
1198276379 X:135098619-135098641 CGCCGACGCCGCCATGGGCCCGG + Intergenic
1198310131 X:135422124-135422146 CGCCGACGCCGCCATGGGCCCGG - Intergenic
1200100889 X:153688673-153688695 GGGCGACGGCCCCGTGGGCCTGG + Exonic