ID: 1185269512

View in Genome Browser
Species Human (GRCh38)
Location 22:49922686-49922708
Sequence CTGGACGAGGGCGCCTGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185269503_1185269512 15 Left 1185269503 22:49922648-49922670 CCAACAGAGACTGCGGCGAGTGT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1185269502_1185269512 20 Left 1185269502 22:49922643-49922665 CCTGACCAACAGAGACTGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185269512 Original CRISPR CTGGACGAGGGCGCCTGTGT GGG Exonic
906679428 1:47715367-47715389 ATGGACGAGGTTGCCTGGGTTGG - Intergenic
914666154 1:149834578-149834600 ATGGACGTGGGGGCTTGTGTCGG + Intergenic
914669611 1:149859216-149859238 ATGGACGTGGGGGCTTGTGTCGG - Intronic
920637489 1:207718361-207718383 CTGGAGGATGGAGCTTGTGTGGG - Intronic
1065955343 10:30688821-30688843 CTGGAGGAGAGCTCCAGTGTGGG + Intergenic
1067142802 10:43670534-43670556 CAGGACGAAGACGCCTGCGTGGG - Intergenic
1072169128 10:92843304-92843326 CTGGAGGAGGGCCCCTGCGACGG + Intronic
1072781921 10:98257347-98257369 CGGCACGAGGGAGTCTGTGTGGG - Intronic
1076896438 10:133315016-133315038 CTGGCCGAGGGTGGCTGTGGTGG + Intronic
1077076164 11:703170-703192 CAGGAGGAGGGCCCCAGTGTGGG - Exonic
1081528940 11:43944827-43944849 CTGGGAGAGGGCCCCAGTGTGGG - Intergenic
1090881110 11:130831893-130831915 CTGGAAGAGGGCACTTGGGTAGG + Intergenic
1097712495 12:62932486-62932508 CAGGGCGAGGGCGCCTGTCAAGG - Intronic
1098751013 12:74293126-74293148 CTGCACAAGGCCGCGTGTGTGGG - Intergenic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1100025529 12:90122850-90122872 CTGCACGAGGGAGCCTCTGCTGG + Intergenic
1103883250 12:124182689-124182711 CTGGAAGAGGGTGGCAGTGTGGG + Intronic
1105365378 13:19759405-19759427 CTGGACGAGGGGTCCTGGATAGG + Exonic
1109222407 13:59653642-59653664 CTGGACAGGGAGGCCTGTGTTGG + Intergenic
1113951742 13:114075706-114075728 CAGGACGAAGCCGCCCGTGTCGG + Intronic
1122802840 14:104240193-104240215 CTGGGCGAGAGCCTCTGTGTGGG + Intergenic
1123933199 15:25181749-25181771 CTGGGATAGGGCACCTGTGTGGG + Intergenic
1125087368 15:35746271-35746293 CTGGAGGAGGAAGCCTGTGTGGG - Intergenic
1130580849 15:85135573-85135595 CTGTGCCAGGGCGCCTGTGCTGG - Intronic
1131913278 15:97232884-97232906 CTGTACCAGGGCACATGTGTTGG - Intergenic
1132750090 16:1453590-1453612 CTGGAGGACGGCCCCTGGGTAGG - Intronic
1135990557 16:27216324-27216346 CTGGACGTGGGTGGATGTGTGGG + Intronic
1137261070 16:46830811-46830833 CTGGAGGAGCGCGCCTTTGGTGG - Intronic
1138537783 16:57668866-57668888 CTGGGAGAGGGAGCCGGTGTGGG - Intronic
1141605795 16:85152615-85152637 CTGGAGGAGGGGGCCTGTTAGGG + Intergenic
1142003862 16:87679878-87679900 TGGGAGGAGGGTGCCTGTGTGGG + Intronic
1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG + Intronic
1147401744 17:40184393-40184415 CTGGAAGGGGGCCCCTGTGAAGG + Intronic
1153480486 18:5543098-5543120 CGGGCCGGGGGCGCCTGGGTCGG - Intronic
1160390069 18:78523391-78523413 GTGGACGTGGGCATCTGTGTGGG + Intergenic
1160618364 18:80151106-80151128 ATGGGGGAGGGCACCTGTGTGGG + Intronic
1160982686 19:1823542-1823564 CTGGCCCAGGGGGCCTGTGCCGG - Intronic
1161151600 19:2713043-2713065 GTGGAGGAGGGGACCTGTGTAGG - Intergenic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
1167512536 19:49903369-49903391 CGGGACAAGGGCGCCCATGTGGG + Intronic
1167797201 19:51717114-51717136 CTGGACGAGGACCCCCGGGTAGG - Exonic
931688651 2:64816492-64816514 CTGGATGCTGGGGCCTGTGTGGG - Intergenic
938722684 2:134080237-134080259 CAGGACGGGGACGCGTGTGTGGG + Intergenic
942360709 2:175168520-175168542 CTGGAGGAGGGCGCGGGTGCAGG + Intergenic
946239796 2:218346534-218346556 CTGGAGGAGGGGGCCTTTGAGGG - Exonic
947717694 2:232350148-232350170 CTGGAGGAGGAGGCCTGTGGAGG + Intergenic
947740759 2:232483821-232483843 CTGGAGGAGGAGGCCTGTGGAGG + Intronic
1170708076 20:18764038-18764060 CTGGACTCAGGAGCCTGTGTGGG - Intergenic
1173922770 20:46758504-46758526 CTGGCTGATGGCCCCTGTGTTGG - Intergenic
1179940568 21:44636952-44636974 CAGGACGGAGGTGCCTGTGTTGG - Intronic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG + Exonic
950696405 3:14704189-14704211 ATGGACGAGGGAGCATGGGTTGG + Intronic
961651356 3:128418154-128418176 CTGGACGAGGGCATCAGCGTAGG - Intergenic
961656842 3:128447340-128447362 CTGGAGGAGGGAGCCAGTGAAGG - Intergenic
966878377 3:184336201-184336223 CTTGAGGAGGGGGCCGGTGTCGG + Intronic
969136060 4:5029712-5029734 CTGGAGATGGGCGCCTGGGTGGG - Intergenic
969523626 4:7693056-7693078 CTGGCCGAGGGTGCCGGTGGCGG + Intronic
985759483 5:1737752-1737774 CAGGAAGAAGGCGCCTTTGTAGG - Intergenic
990353105 5:54938672-54938694 CTGGACATGGGGGCCTTTGTAGG - Intergenic
1002399542 5:178983902-178983924 CTGTACGAGAGCGCCTGATTGGG + Intronic
1005816260 6:29555026-29555048 CAGGATGAGGGCGCCAGTCTGGG - Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1011527240 6:88278089-88278111 CTGGACGTGGGAGCCTGGCTGGG - Intergenic
1018860552 6:167708115-167708137 CAGGGGGAGGGTGCCTGTGTTGG + Intergenic
1019330972 7:460633-460655 CAGGCCGAGAGCGCCTGTGAGGG + Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1035574834 8:697712-697734 CTTGAGAGGGGCGCCTGTGTGGG - Intronic
1049437768 8:142595593-142595615 CTGGCCAAGGGCGCCTGGGGTGG - Intergenic
1060412308 9:123407936-123407958 CTGGACGAAGGGGCATGGGTTGG - Intronic
1061620275 9:131807320-131807342 CTGGAGGAGAGCGCCGGTGGGGG + Intergenic
1185520675 X:736307-736329 CTGGAGGAGGGGCTCTGTGTGGG - Intergenic
1192076283 X:68001250-68001272 CTGGAGGAGGTCCCCAGTGTTGG + Intergenic
1198374678 X:136026919-136026941 CTGGAAGAGGGGGCCTCTGCTGG + Intronic
1201750110 Y:17422726-17422748 CTGGAACAGGGAGCATGTGTTGG - Intergenic