ID: 1185269797

View in Genome Browser
Species Human (GRCh38)
Location 22:49924114-49924136
Sequence TGGAACTCTTTGGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185269797_1185269803 -1 Left 1185269797 22:49924114-49924136 CCAGTTTCTCCCAAAGAGTTCCA 0: 1
1: 0
2: 4
3: 35
4: 203
Right 1185269803 22:49924136-49924158 AAGCCAGGTGGTCTGCACCATGG 0: 1
1: 0
2: 1
3: 20
4: 202
1185269797_1185269806 8 Left 1185269797 22:49924114-49924136 CCAGTTTCTCCCAAAGAGTTCCA 0: 1
1: 0
2: 4
3: 35
4: 203
Right 1185269806 22:49924145-49924167 GGTCTGCACCATGGCTCTCCGGG 0: 1
1: 0
2: 0
3: 22
4: 180
1185269797_1185269805 7 Left 1185269797 22:49924114-49924136 CCAGTTTCTCCCAAAGAGTTCCA 0: 1
1: 0
2: 4
3: 35
4: 203
Right 1185269805 22:49924144-49924166 TGGTCTGCACCATGGCTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 148
1185269797_1185269809 28 Left 1185269797 22:49924114-49924136 CCAGTTTCTCCCAAAGAGTTCCA 0: 1
1: 0
2: 4
3: 35
4: 203
Right 1185269809 22:49924165-49924187 GGGAGCACCTGCTGCACAGCAGG 0: 1
1: 2
2: 3
3: 35
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185269797 Original CRISPR TGGAACTCTTTGGGAGAAAC TGG (reversed) Intronic
900836847 1:5011289-5011311 CAGAGCTCTTTGGAAGAAACAGG - Intergenic
901176708 1:7306710-7306732 TAGATCACTTTGGGGGAAACTGG + Intronic
903328756 1:22586278-22586300 TGGAACCCTGTGGAAGACACAGG + Intronic
904215973 1:28919624-28919646 TTGTATTCTTTGGTAGAAACGGG + Intronic
904887404 1:33751227-33751249 TTGAACTTTTTGAGAGAAAGGGG + Intronic
905033402 1:34902450-34902472 TGGTACCCAGTGGGAGAAACAGG + Intronic
905932702 1:41800848-41800870 TGGAACATTATGGGAGAAGCAGG - Intronic
911057323 1:93720173-93720195 TGGAACTTCAGGGGAGAAACAGG - Intronic
911262522 1:95702574-95702596 TGCAACACTTTGGGAGACAGAGG - Intergenic
913553079 1:119936037-119936059 TGGATCTATGTGTGAGAAACTGG + Intronic
917744779 1:177996713-177996735 TTGTACTTTTTGGTAGAAACAGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921600616 1:217102761-217102783 TCTTACTCTTTGGGAGACACTGG + Intronic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923071148 1:230565487-230565509 AGGAACTCACTGGGAGAAGCTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063978370 10:11434792-11434814 TGGAATTTATTGGGAGAAAACGG + Intergenic
1065318682 10:24488507-24488529 TAGATCTATTTGGGAGACACTGG - Intronic
1069164179 10:65129523-65129545 TGCAACTTTTTGGGGGATACAGG + Intergenic
1069221884 10:65893698-65893720 TGGAACTCATAAAGAGAAACAGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071988172 10:91073560-91073582 TGGAACTCATGAGGACAAACTGG + Intergenic
1072675220 10:97460616-97460638 TGGAAGTCCTTGGGAGGAATAGG + Intronic
1077709265 11:4519676-4519698 TGCAACTCTTGGGAAGTAACTGG - Intergenic
1078102690 11:8339085-8339107 AGGAATTCTTTGGGGGAAAGTGG + Intergenic
1078570003 11:12449520-12449542 GGGAACTCATTGACAGAAACAGG - Intronic
1080132161 11:28809077-28809099 TGAAGCACTTTGGGAGAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085484302 11:76848948-76848970 TAGAACTCTTTGGTTGGAACAGG - Intergenic
1085709899 11:78819839-78819861 AGGAACTCTTTGGGAACACCTGG + Intronic
1086153781 11:83643298-83643320 TGAAACTCTGTGGGGGAAAATGG + Intronic
1087383794 11:97443734-97443756 TGGAACTCATTGGGATGAATTGG - Intergenic
1087721160 11:101666650-101666672 AGGAACTTTGTGGGAGAAAGGGG - Intronic
1087837625 11:102890698-102890720 TGGAACTCCTTAGCAGAATCTGG - Intergenic
1087863913 11:103199413-103199435 TGGAAATCTTTGGAGAAAACAGG - Exonic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1088783653 11:113161399-113161421 TGGAACTCTTTCGGGGGCACAGG - Intronic
1089105610 11:116000953-116000975 AGGAGCTCTTTGACAGAAACTGG + Intergenic
1090471074 11:126981748-126981770 AGGCCCTCTTTGGTAGAAACGGG - Intronic
1091292015 11:134446000-134446022 TGGAACTCACTGGGTGAGACAGG + Intergenic
1092614062 12:10200294-10200316 TACAACTCTTTGGGAGAGAGAGG - Intergenic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095520111 12:43053357-43053379 TTGAACTTATTGGGAGAATCTGG - Intergenic
1097188569 12:57208768-57208790 TGGGACGCTTCGGGAGACACTGG + Exonic
1097682515 12:62662026-62662048 AGGATCTCTTTGGAACAAACAGG - Intronic
1101410025 12:104459546-104459568 TGGAATTCTTTGTGAGAATTGGG + Intronic
1103480133 12:121245361-121245383 TGGCAGACTTTGAGAGAAACTGG + Intronic
1104752010 12:131245822-131245844 TAGAAGTGTTTGGGAGAAAAAGG + Intergenic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1105947294 13:25201242-25201264 TGGAAAGCTTAGGGAGAAACGGG - Intergenic
1106832466 13:33599961-33599983 TGGATCTCTTTGGTATAAAGGGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108421545 13:50254905-50254927 TCTTACTCTTTGGGAGCAACTGG + Intronic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1109628279 13:65008423-65008445 TTTAATTCTTAGGGAGAAACGGG + Intergenic
1110567320 13:76969389-76969411 GGAAACTCTTTGGGGGATACTGG + Intergenic
1112700135 13:101998422-101998444 CAGAACTCTTTGGGAGAGAATGG + Intronic
1113889154 13:113726880-113726902 TGCAACTCTTTTGGGGAAAAAGG + Intronic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1114452376 14:22835930-22835952 TGGAACTCGCTGGGAGGAAAAGG - Intergenic
1114572692 14:23684670-23684692 GTGAACTCTATGGGAGGAACAGG + Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1117459364 14:55929420-55929442 TGAAACCCTGTGGTAGAAACAGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119507661 14:75186872-75186894 TGAGACTCTATGGGAGAAAGAGG + Intergenic
1119929804 14:78534049-78534071 TGGTGCACTTTGGGAGAAATGGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122667526 14:103342853-103342875 TGGAATTCTGTAGGAGATACTGG + Exonic
1124599462 15:31120285-31120307 TGGAACTTATTGGGATAAATAGG + Intronic
1125306987 15:38328885-38328907 TGTATCTTTTTGGTAGAAACGGG + Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1131664353 15:94554762-94554784 TTGAAACATTTGGGAGAAACGGG + Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1131804545 15:96107698-96107720 TGGAGAACTTTGGGAAAAACTGG - Intergenic
1133621433 16:7530473-7530495 TGGAAGTCTTTGTGAGAATAAGG - Intronic
1135096467 16:19568642-19568664 AGGAGCTCTGTGGGAGGAACTGG + Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136291403 16:29274463-29274485 TGCAACTCTGAGAGAGAAACTGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138377816 16:56578247-56578269 TGGTATTTTTTGGTAGAAACAGG - Intergenic
1140228805 16:73100437-73100459 TGCAACTCTTTGGCAGAATTTGG + Intergenic
1141393222 16:83681679-83681701 GGGAGCTCTTTGGGAAAAAGAGG + Intronic
1142097277 16:88248382-88248404 TGCAACTCTGAGAGAGAAACTGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146423219 17:32709197-32709219 TGGAACACTTTGAGAGTAAAAGG + Intronic
1148643053 17:49202537-49202559 TGGACCTCTTTGGGTGAGCCTGG + Intergenic
1152305517 17:79518358-79518380 TGACACTGTTTGGGAGAAGCGGG + Intergenic
1153672076 18:7420995-7421017 TGAGACACTTAGGGAGAAACAGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1154507251 18:15053964-15053986 GAGAATTCTGTGGGAGAAACTGG + Intergenic
1155071010 18:22316303-22316325 GGGAACTCTTTGCCAGGAACTGG - Intergenic
1156853241 18:41752883-41752905 TGGAAGTCTCAGGGAGAAACAGG - Intergenic
1157407652 18:47436741-47436763 GTGAACTCTTTGGGGGCAACAGG - Intergenic
1158803219 18:60937878-60937900 TGGAACATTTTGGGGGAAAGGGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167666612 19:50826087-50826109 TGGCTCTGTTTGGGATAAACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926100797 2:10115974-10115996 TGGAACCCTTTGAGATTAACTGG - Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
928533128 2:32212767-32212789 TTGAATTTTTTGGTAGAAACAGG + Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929158921 2:38812406-38812428 TGAAACTCTCTGGGGGAAAATGG + Intronic
929928738 2:46235918-46235940 TGCAAGTCTTAGGGAGAAATGGG + Intergenic
930616282 2:53598093-53598115 AAGAACTCTTTGGAAGAACCCGG - Intronic
931084273 2:58811763-58811785 TGGAACTCTGTGGGTGGAAGTGG + Intergenic
931700409 2:64904483-64904505 TCAAACTCTTTTGGAGAAGCAGG - Intergenic
932811576 2:74830817-74830839 GGGAACTATTTGAGATAAACTGG + Intergenic
935030855 2:99320727-99320749 TGGAAGTCTTTAGGAGTAAAGGG + Intronic
935556180 2:104511968-104511990 TCGACCTCCTTAGGAGAAACTGG + Intergenic
936884313 2:117291700-117291722 TGCAACTATATGGGTGAAACTGG + Intergenic
938762405 2:134437703-134437725 TGTAATTCTTTAGGAGCAACTGG - Intronic
939671886 2:145022847-145022869 TGGAACTCATTGCAAGAAACTGG + Intergenic
939766204 2:146252600-146252622 TGGAAATGCTTGGGAGAAAGAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942771741 2:179529354-179529376 TGGAAATCTTTAGGGGAGACAGG + Intronic
942962181 2:181844151-181844173 TCGAACACTTTGGGAGACCCAGG - Intergenic
944724327 2:202454623-202454645 AGGAAGTCTTTAGGAGAAGCAGG + Intronic
944895525 2:204160056-204160078 TGGAACTATTTGAGAGAGAAGGG + Intergenic
945586752 2:211674982-211675004 TGGAAATCTATGGAAGAAAAGGG - Intronic
947618466 2:231573850-231573872 TGGATTTGTTTGGAAGAAACAGG - Intergenic
948603833 2:239122434-239122456 TGGAACTCTGCAGGTGAAACTGG - Intronic
1168887531 20:1270057-1270079 GGGAACTCTTGGAGGGAAACTGG - Intronic
1170433906 20:16304138-16304160 TGGAAGTCTAGGGGAGAAAAGGG - Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1172419186 20:34799501-34799523 TAGTACTCTTTGGGTTAAACTGG - Intronic
1177635874 21:23785675-23785697 TGGATTTCTTTGAGAGACACCGG - Intergenic
1178363373 21:31968404-31968426 AGGAACTCCTCGGGAGAGACGGG + Intronic
1180034418 21:45236382-45236404 TGTACCTCTCAGGGAGAAACGGG + Intergenic
1180215561 21:46321797-46321819 TTGCACTCTTTGGGAGGAAGTGG + Intronic
1181285805 22:21751562-21751584 TGGTACTTTTTAGTAGAAACGGG + Intergenic
1181821902 22:25483000-25483022 TGGAACTCTTCTGCACAAACAGG - Intergenic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
951091501 3:18579004-18579026 TGGAACTCTTTGCCAGAAATAGG - Intergenic
953022287 3:39122490-39122512 TGGAACTCTTTGGGGAAAGCTGG - Intronic
957212555 3:77278257-77278279 TGGAAGTCTATGGGAGCTACTGG - Intronic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
959135245 3:102410696-102410718 AAGAATTCTTTTGGAGAAACAGG + Intronic
959289121 3:104450033-104450055 TGGAAGAATTTGGGATAAACTGG - Intergenic
960948778 3:122984903-122984925 AAGAAGTCTTTGGGAGAAACAGG - Intronic
961448929 3:126993661-126993683 TGGCACCCTTTGGGAGCATCTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964596127 3:158431106-158431128 TGGAACAGTTTGGGAAATACTGG + Intronic
965890249 3:173504610-173504632 TGGAAATCTTGGGTATAAACAGG - Intronic
965925665 3:173976395-173976417 TAAAACTCATTGGGAGTAACAGG + Intronic
966299872 3:178466089-178466111 TGGAGTTCTTTGGTTGAAACTGG - Intronic
966578655 3:181534062-181534084 TGAACCTATTTGGTAGAAACAGG + Intergenic
967789621 3:193533289-193533311 TTGAACTCATTGAGAGAAATTGG - Intronic
968057829 3:195706203-195706225 TGGCACTTTTTGGTAGAGACAGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972230772 4:37070324-37070346 TGGTACCCTTTGGGAGAGAAGGG - Intergenic
974007291 4:56571486-56571508 TGGATTTTTTTGGTAGAAACAGG + Intronic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
974610123 4:64206114-64206136 TGGCTCTCATTGGGAGGAACGGG + Intergenic
976036098 4:80823083-80823105 TGGAATTCTTTAAGACAAACTGG - Intronic
976521809 4:86036753-86036775 TGGAACTATTTTGTACAAACTGG - Intronic
977691812 4:99919753-99919775 TTGTACTCATTGGGAGAAATGGG + Intronic
980440273 4:132834623-132834645 TGGACCTCTTGGGAGGAAACAGG + Intergenic
982664516 4:158245074-158245096 TGGAGGTCTTTGGGAGACATAGG - Intronic
984041906 4:174745292-174745314 TGTATCTCTTTGGGGGACACTGG - Intronic
984817210 4:183849918-183849940 TGCAGCTATTTGGGAGAAACTGG - Intergenic
987623133 5:20362954-20362976 TGGAGCTTTATGGTAGAAACAGG + Intronic
988497920 5:31760461-31760483 TGGAGATCTTTGGGAGAAAGTGG + Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
991917050 5:71615725-71615747 AGGAACTCTGTCGGAGGAACTGG - Intronic
992069240 5:73134880-73134902 TGAAACTCTCAGGTAGAAACTGG - Intergenic
992758349 5:79930225-79930247 AGGAAGTCTGTGGGAGGAACTGG + Intergenic
994910980 5:105907097-105907119 AGGAACACTTTGAGAGAAAAAGG + Intergenic
996151550 5:120042145-120042167 TGGAAACCTTTAGGAGAAAAGGG + Intergenic
999861209 5:155648492-155648514 GGGAAATCTTTCAGAGAAACTGG - Intergenic
1000812012 5:165874750-165874772 GGGAACACTGTGGGAGGAACAGG + Intergenic
1001147593 5:169198350-169198372 TAGAACTCTTTAGGAGACAGAGG + Intronic
1002312050 5:178320730-178320752 TGAAACTCTTTGGCGGAAGCCGG - Intronic
1005981551 6:30840677-30840699 TGGAATTTTTTGGGTGAAAAAGG + Intergenic
1006529211 6:34635922-34635944 TGGAAATCTTAAGAAGAAACTGG + Intronic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010741481 6:79510491-79510513 AGAAAGTCTTTGGGACAAACAGG + Intronic
1012330941 6:97986236-97986258 TGGTAACCATTGGGAGAAACTGG + Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1014122269 6:117739067-117739089 TGGAACTCTTTTTGAGAAATTGG - Intergenic
1015311678 6:131773724-131773746 TTGAACTCCTTGGTTGAAACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015510634 6:134034919-134034941 TGGCACTTTTTGGGAGAACTGGG - Intronic
1015573669 6:134648181-134648203 TAGAACTCTTTGGAAGCATCGGG - Intergenic
1017326915 6:153150822-153150844 TGGAACTCTTGGGCAGGACCGGG - Intergenic
1017378674 6:153801067-153801089 TGAAGCTCTTTGTCAGAAACTGG + Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021215586 7:17912300-17912322 TGTCAGTGTTTGGGAGAAACAGG - Intronic
1021944355 7:25711566-25711588 TGGAAATTTTTGGGAAAAATGGG - Intergenic
1027553356 7:79630065-79630087 TTGAACATTTTGGGGGAAACAGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030274358 7:107703879-107703901 TGTTACTCATTGGGAGAAACTGG - Intronic
1031899070 7:127391016-127391038 TTGAACTCATTGGGAGAATCAGG - Intronic
1032948786 7:136883269-136883291 TAGTACCCTTTGGGAGACACCGG - Intronic
1036432131 8:8701706-8701728 TGGAACCCTCTGGGAGTAAAGGG + Intergenic
1036584026 8:10106537-10106559 TGCAACTCTGTGAGAGAGACTGG + Intronic
1036744509 8:11395246-11395268 TAGAACTCTTATGAAGAAACTGG - Intronic
1037682629 8:21110190-21110212 TTGTACTTTTTGGGAGAGACAGG - Intergenic
1038161683 8:25045593-25045615 TGGATCTTTTTGGGAGAAGAAGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039384639 8:37123494-37123516 TGGTACTCTGGGTGAGAAACTGG + Intergenic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041241694 8:55853837-55853859 TGGAAGTCTCTTGGAGGAACTGG + Intergenic
1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG + Intergenic
1041544769 8:59030567-59030589 TGGAACACTTTGTGAACAACTGG - Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048664399 8:136644391-136644413 TGGGACACTTTGAGGGAAACTGG + Intergenic
1049465959 8:142751438-142751460 TGGAAGTGTTTGGGAGACTCAGG + Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1053447335 9:38163235-38163257 CGGAACTCTTTGGGATAAGTAGG - Intergenic
1056068892 9:82965385-82965407 GGGAAGTATTTGGGAGAAACAGG - Intergenic
1056951643 9:91044818-91044840 TGGAGCTCAAGGGGAGAAACTGG - Intergenic
1057359312 9:94358795-94358817 TGGAACACTTTGGGAGGCCCAGG + Intergenic
1057558291 9:96106881-96106903 TGTAATTTTTTGTGAGAAACTGG + Exonic
1057648453 9:96898795-96898817 TGGAACACTTTGGGAGGCCCAGG - Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058981363 9:110173655-110173677 TGGAAATCCTGGGGAGAAAAAGG - Intergenic
1059210474 9:112510147-112510169 TGAAACTGTTTGGGAGAAGCTGG + Intronic
1059624048 9:116041812-116041834 TGGAACTCTGAGGGAGTAATCGG - Intergenic
1059715511 9:116909469-116909491 GGGAAAACTGTGGGAGAAACAGG + Intronic
1186961225 X:14738407-14738429 TGGAAGCTTTTGGGAGAAAGTGG + Intergenic
1188697496 X:33213721-33213743 AGTTAATCTTTGGGAGAAACTGG - Intronic
1188774480 X:34197175-34197197 AGGAAGACTGTGGGAGAAACTGG + Intergenic
1190495749 X:51027120-51027142 TGAAACCCTTTGGGTGAAAGCGG + Intergenic
1190510172 X:51166478-51166500 TGAAACTCTTTAGGTGAAAGTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193535386 X:82709327-82709349 GGAAACTATCTGGGAGAAACTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1197130601 X:123001546-123001568 GGGAATTCTTTGGGAAAACCAGG - Intergenic
1197202538 X:123760546-123760568 TGAAAGTTTATGGGAGAAACTGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic