ID: 1185269824

View in Genome Browser
Species Human (GRCh38)
Location 22:49924279-49924301
Sequence CCCCGACATGCACAAGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185269824_1185269829 -8 Left 1185269824 22:49924279-49924301 CCGGTGCCTTGTGCATGTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1185269829 22:49924294-49924316 TGTCGGGGTCTGACGGGCACTGG 0: 1
1: 0
2: 0
3: 6
4: 96
1185269824_1185269830 9 Left 1185269824 22:49924279-49924301 CCGGTGCCTTGTGCATGTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1185269830 22:49924311-49924333 CACTGGTGCCTTGTGCATGTCGG 0: 1
1: 1
2: 1
3: 10
4: 179
1185269824_1185269831 10 Left 1185269824 22:49924279-49924301 CCGGTGCCTTGTGCATGTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1185269831 22:49924312-49924334 ACTGGTGCCTTGTGCATGTCGGG 0: 1
1: 1
2: 0
3: 13
4: 106
1185269824_1185269834 22 Left 1185269824 22:49924279-49924301 CCGGTGCCTTGTGCATGTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1185269834 22:49924324-49924346 TGCATGTCGGGGTCTGACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1185269824_1185269832 11 Left 1185269824 22:49924279-49924301 CCGGTGCCTTGTGCATGTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1185269832 22:49924313-49924335 CTGGTGCCTTGTGCATGTCGGGG 0: 1
1: 1
2: 0
3: 2
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185269824 Original CRISPR CCCCGACATGCACAAGGCAC CGG (reversed) Intronic
902520265 1:17011791-17011813 CCCCGGCGTGCGCAAGGCCCTGG + Intronic
906679985 1:47719980-47720002 CCACCACATGCACAAGGTTCGGG - Intergenic
920948561 1:210552391-210552413 CTCAGCCAGGCACAAGGCACAGG - Intronic
922743787 1:228031687-228031709 CAGCCACATGCACACGGCACAGG - Intronic
923436465 1:233971980-233972002 CCCTGACACACACACGGCACTGG - Intronic
1062805781 10:418315-418337 CCCCGACAGGCACAGTGGACAGG - Intronic
1062983449 10:1744790-1744812 CCCCGATCTGCAGAAGGCACCGG + Intergenic
1063968085 10:11362429-11362451 CAGGGACATTCACAAGGCACAGG + Intergenic
1064850636 10:19705511-19705533 CCAATACATGCACAAGGGACTGG - Intronic
1070508786 10:77140721-77140743 CCCCGGCATGCTCTGGGCACTGG + Intronic
1073152629 10:101322308-101322330 CCCAGACATGCAAGAGGCAAAGG + Intergenic
1073209033 10:101783418-101783440 CCCCGACACGCACAAAGCCGGGG + Intergenic
1076852843 10:133101529-133101551 CCCCCAAATGCACATGGCACGGG + Intronic
1077088268 11:765487-765509 GCACGACATGCACCAGCCACTGG + Intergenic
1077228927 11:1450137-1450159 CCCCCGCATGCACACGGCACAGG - Intronic
1077461211 11:2711599-2711621 CACGGCCATGCACAAGGCACAGG + Intronic
1077959325 11:7057087-7057109 CCCCAACATGTACAAGGCACAGG + Intronic
1089609525 11:119661650-119661672 CCCCCACTTGCCCAAGTCACTGG - Exonic
1090867008 11:130709929-130709951 CCCTGACCTTCCCAAGGCACAGG - Intronic
1094847935 12:34369559-34369581 ACCACACATGCACAAGGCCCAGG - Intergenic
1094849204 12:34374823-34374845 ACCGCACATGCACAAGGCCCAGG - Intergenic
1096282884 12:50271765-50271787 CCCCTACATGTTCCAGGCACTGG - Intronic
1104360166 12:128125647-128125669 CCCATACATGCACAAAGCAAAGG - Intergenic
1108083054 13:46757068-46757090 CCCCGCCATGCAGAAAGCTCTGG + Intergenic
1108555012 13:51583890-51583912 TCCCAACATGCACCAGGCCCAGG - Intergenic
1118492161 14:66271817-66271839 ACCCCACTTGCACAAGACACAGG + Intergenic
1118823894 14:69363194-69363216 CCCCCACAAGCAGAGGGCACTGG - Intergenic
1121304609 14:92898229-92898251 CCCTGACATGTTCCAGGCACTGG + Intergenic
1122229361 14:100297899-100297921 CCCGGACCTGCACAAGGCCCAGG + Intronic
1122468297 14:101949061-101949083 CCCCGGCCTGCCCAAGGTACTGG + Intergenic
1123956928 15:25346153-25346175 CCACAACAGGCACAAGGCTCAGG + Intronic
1128707259 15:69845703-69845725 CCCACACATACACAGGGCACAGG - Intergenic
1129149965 15:73682457-73682479 CACCGCAAGGCACAAGGCACAGG + Intergenic
1129245164 15:74274815-74274837 CCCACACATGCAAAAGGCACTGG - Intronic
1130530555 15:84745099-84745121 TCCTGACATGCAAAAGACACAGG + Intergenic
1131462597 15:92629130-92629152 CCCAGACATGCAGAAGCCATGGG + Intronic
1132075460 15:98816275-98816297 ACCTGATATGCACAAGGTACTGG - Intronic
1136016296 16:27403234-27403256 CCTCCACATGCACAGGGAACTGG - Intronic
1137587185 16:49670613-49670635 CCCCGAGATGCAGATGGCACAGG - Intronic
1141694009 16:85611596-85611618 CCCCGCCTTGCACAAGGCTCCGG - Intronic
1141899996 16:86984936-86984958 CCCCGACCTGTAAAAGCCACTGG + Intergenic
1152124380 17:78437655-78437677 CGCCAACTTGCACAAGGCCCTGG - Exonic
1152495762 17:80670291-80670313 TCCCGACACGGACAAGGGACGGG - Intronic
1154324508 18:13380201-13380223 CACCCACATGCACAAGGGAATGG - Intronic
1155235649 18:23816449-23816471 CCACGACATGCTCTCGGCACTGG - Exonic
1155300852 18:24427231-24427253 CGCCCACGTGAACAAGGCACAGG - Intronic
1156516852 18:37687467-37687489 CCCAGTACTGCACAAGGCACAGG - Intergenic
1161644856 19:5447019-5447041 CCCAGAGTTGCAGAAGGCACAGG - Intergenic
1164207236 19:23069148-23069170 GACCCACATGCACAGGGCACAGG + Intergenic
1168466489 19:56606219-56606241 GCCTGCCATGCACCAGGCACTGG - Intronic
924979038 2:203571-203593 CCCTGCCATGCACCAGGCATGGG + Intergenic
926381145 2:12291113-12291135 CACAGACATGCACAAGGAAATGG - Intergenic
936811874 2:116412765-116412787 CCATGAGAAGCACAAGGCACAGG - Intergenic
937438845 2:121900321-121900343 CCCCGAAAGTCACCAGGCACAGG - Intergenic
938281139 2:130064424-130064446 CCCGGACATGCACAGGCCCCAGG + Intergenic
938281578 2:130067168-130067190 CCCGGACATGCACAGGCCCCAGG + Intergenic
946174367 2:217913464-217913486 CCCCGACCTGGCCAGGGCACTGG + Intronic
948513726 2:238489693-238489715 CCCCGCCATGCCCAATGCACAGG - Intergenic
949023406 2:241753793-241753815 GCCCGGCAGGCACAGGGCACAGG - Intronic
1169317920 20:4608754-4608776 TCCTGACATGGACAGGGCACAGG + Intergenic
1169404901 20:5315098-5315120 CCCCACTATGCACCAGGCACTGG - Intergenic
1169802991 20:9530437-9530459 CCCCGACTTGGACCTGGCACAGG - Exonic
1171079755 20:22166793-22166815 CCCACACATTCAGAAGGCACAGG - Intergenic
1173599136 20:44280281-44280303 TCCCAACATGCAAAAGGCACAGG - Exonic
1174038127 20:47680600-47680622 GCCCGACGTTCACAGGGCACTGG - Intronic
1180696776 22:17756323-17756345 GCCCAACAGCCACAAGGCACTGG + Intronic
1183736455 22:39647380-39647402 CCACGACAAGCACAGAGCACAGG - Intronic
1185010036 22:48307696-48307718 CCCCAAAAGGCACAGGGCACTGG + Intergenic
1185223556 22:49640837-49640859 TCCCAACACGCACAAGGCACTGG + Intronic
1185269824 22:49924279-49924301 CCCCGACATGCACAAGGCACCGG - Intronic
950436356 3:12982843-12982865 GCCTGCCATGCACCAGGCACTGG + Intronic
951203367 3:19899227-19899249 CTCCAAAATGCAGAAGGCACTGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
955371905 3:58359030-58359052 CCCCAGCATGAACAAAGCACGGG + Intronic
956171110 3:66433841-66433863 CCCCAGCATGGACAAGGCACGGG - Intronic
968603252 4:1520315-1520337 CCCCGGCACCCACAAGCCACGGG + Intergenic
969175511 4:5395942-5395964 CCCCCACATCCACATTGCACCGG - Intronic
969623841 4:8292589-8292611 CCCTGACAGGCACATGGCCCTGG - Intronic
986671702 5:10148333-10148355 CCCCGACCAGCACAAGGGATGGG + Intergenic
988423094 5:31030103-31030125 CCCCTAGAGGCAGAAGGCACGGG + Intergenic
988708277 5:33747058-33747080 CCCTGACTGGCACATGGCACTGG + Intronic
992206861 5:74439327-74439349 ACTGGACATGCACCAGGCACTGG - Intergenic
993660796 5:90631708-90631730 CCCTGGCATCCACAAGCCACAGG - Intronic
995305225 5:110639080-110639102 CCCTGACATGCTCAAGGGACAGG + Intronic
1001445064 5:171776523-171776545 CACCCACATGCACCAGGCAAAGG + Intergenic
1002452091 5:179325006-179325028 CCCCGACACACACTAGGCCCTGG + Intronic
1004260677 6:14104840-14104862 CCCAGCCACGCACAAGGAACTGG + Intergenic
1004913181 6:20306657-20306679 ACGCGAGATGCACAAGGCAGAGG + Intergenic
1022808890 7:33849732-33849754 CCCAGACAGGCACAAGCCAGTGG - Intergenic
1024598984 7:50963116-50963138 CCCAGGCAGGCACAAGGCACTGG + Intergenic
1026550376 7:71363333-71363355 CCCTGAAATGCACCAGGCACTGG + Intronic
1033214553 7:139483832-139483854 CCCCGGCCTCCACCAGGCACTGG + Intergenic
1036941417 8:13056235-13056257 TCCAGATATGCACAAGGCGCTGG + Intergenic
1038328481 8:26589884-26589906 CCGGGACAAGCCCAAGGCACTGG - Intronic
1038403015 8:27299802-27299824 CTCCCACATGCAAAATGCACTGG - Intronic
1038425789 8:27463032-27463054 ACCCCACATGCAGAAGGCACTGG - Exonic
1038450741 8:27637415-27637437 CCCCAAGATGCCCAAGACACAGG + Intronic
1039643116 8:39245560-39245582 CCTCTACATGCACAAGCCCCTGG - Intronic
1049633392 8:143672088-143672110 CCCCGCCCTGCGCAAGGCACAGG - Intergenic
1051342283 9:16122592-16122614 CCCAGCCATTCACCAGGCACTGG + Intergenic
1056578349 9:87872489-87872511 GACCCACATGCAGAAGGCACAGG - Intergenic
1060187902 9:121575043-121575065 CCCCGCCCTGCTCCAGGCACAGG - Intronic
1060756673 9:126219073-126219095 CCCCGACGTGCTCAGGGCTCAGG + Intergenic
1190057549 X:47190639-47190661 CCACCACGTGCACCAGGCACTGG + Intergenic
1199571379 X:149270299-149270321 CCCCCACATGTCCCAGGCACAGG + Intergenic
1200234628 X:154462318-154462340 CCCCCACATGCCCAGGGCTCTGG - Intronic