ID: 1185270098

View in Genome Browser
Species Human (GRCh38)
Location 22:49925803-49925825
Sequence TCTGAAGCTCAGACCTCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185270088_1185270098 26 Left 1185270088 22:49925754-49925776 CCCCAGGTTCACAGCTCAAACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG 0: 1
1: 0
2: 2
3: 32
4: 247
1185270090_1185270098 25 Left 1185270090 22:49925755-49925777 CCCAGGTTCACAGCTCAAACGGA 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG 0: 1
1: 0
2: 2
3: 32
4: 247
1185270091_1185270098 24 Left 1185270091 22:49925756-49925778 CCAGGTTCACAGCTCAAACGGAA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG 0: 1
1: 0
2: 2
3: 32
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185270098 Original CRISPR TCTGAAGCTCAGACCTCAGC GGG Intronic
900154020 1:1196919-1196941 TCTGAAGCTCTGGCCTGAGGGGG - Intronic
900525290 1:3125524-3125546 TCTGAAGCACAGGCCTCTGGGGG + Intronic
900564423 1:3325333-3325355 GCTGATGCTCAGGCCTGAGCTGG - Intronic
901838345 1:11938472-11938494 GCTAAAGGTCACACCTCAGCTGG - Intronic
902227505 1:15005999-15006021 CTTGAAGATCAGAACTCAGCTGG + Intronic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903439992 1:23380521-23380543 TCTGAAGCTCAGGTCACAGATGG + Intergenic
904346636 1:29876664-29876686 TATAAACCCCAGACCTCAGCTGG + Intergenic
905187865 1:36209710-36209732 TCTGAATCCTAGTCCTCAGCAGG + Intergenic
906695758 1:47822423-47822445 AGGGAAGCTCAGAGCTCAGCAGG - Intronic
907316322 1:53574954-53574976 TCTGAACCTCACATCTCATCTGG + Intronic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
908333522 1:63096473-63096495 TCTGAAGCTAAGAGAGCAGCAGG + Intergenic
908387663 1:63657985-63658007 TCTGAACCATAGTCCTCAGCAGG + Intronic
908448199 1:64222427-64222449 GCTGAAGCTGAGACCACAGAAGG - Intronic
908597499 1:65704075-65704097 TCTGCAGCACCCACCTCAGCAGG - Intergenic
910966682 1:92815105-92815127 TCTCAAGCTCAGGCCTTAACAGG + Intergenic
911150045 1:94589790-94589812 CCTCAAGCCCAGAGCTCAGCCGG + Intergenic
912181746 1:107227088-107227110 GCTGAAACTCAGACCCCAGGAGG - Intronic
913547727 1:119886083-119886105 TCTGACCCTGAGCCCTCAGCTGG - Intergenic
915090046 1:153417808-153417830 TCTGAAGCACTGTCCACAGCTGG + Intronic
915095439 1:153459268-153459290 TCTGAAGCACTGTCCACAGCTGG - Intronic
916040145 1:160954661-160954683 TCTAAAACTGAGACCTGAGCTGG + Intronic
916454347 1:164955121-164955143 GCAGAAGCTCCTACCTCAGCGGG - Intergenic
918417699 1:184329097-184329119 TGTGAAGCTGTGGCCTCAGCTGG + Intergenic
918990481 1:191692537-191692559 TATAAACCCCAGACCTCAGCTGG + Intergenic
919743214 1:200992766-200992788 TCTGCAGCTCAGCCTTCAGCAGG - Intronic
920764556 1:208819504-208819526 TCTGAAGTCAAGACATCAGCAGG + Intergenic
1063547693 10:6998351-6998373 CCTGAGGCTCAGACCTCACCAGG + Intergenic
1064032519 10:11891918-11891940 ACCGCAGCTCAGAGCTCAGCGGG - Intergenic
1066232760 10:33453572-33453594 CCTGAAGCTCAGAGCTCATTAGG + Intergenic
1066272513 10:33837368-33837390 TATAAACCCCAGACCTCAGCTGG + Intergenic
1070251177 10:74774374-74774396 TCTGAAGCCCATACATCAGTAGG + Intergenic
1070664662 10:78334499-78334521 TCTGAAGCTAAGGTATCAGCAGG - Intergenic
1072953973 10:99872804-99872826 ACTGATGCTCAGAGCCCAGCAGG - Intergenic
1074234497 10:111571731-111571753 TCTTAACCTCACACCCCAGCAGG - Intergenic
1074284156 10:112082293-112082315 TCTGGAGCTCAAATCCCAGCTGG - Intergenic
1074451022 10:113559802-113559824 GCTGCAGCTCAGCCCTTAGCTGG + Intronic
1074715714 10:116216733-116216755 TCTGTAGCTCAAACCACAGGAGG - Intronic
1075322449 10:121502943-121502965 TCTGAACTGCAAACCTCAGCAGG - Intronic
1080250240 11:30225782-30225804 GCAGAAGCTCAAACCACAGCTGG + Intergenic
1081013754 11:37849729-37849751 TATGAAACTCAGTCATCAGCAGG - Intergenic
1083290995 11:61690051-61690073 CTGGAAGCTCAGGCCTCAGCTGG - Intronic
1083332535 11:61905627-61905649 TCAGAAGCTCAGAGCTCAGGAGG + Intronic
1083872562 11:65498068-65498090 TCTGAAGCTCATACCTAACCAGG + Intergenic
1083883493 11:65559336-65559358 TCTGACTCACAGAACTCAGCAGG + Intergenic
1083988569 11:66232831-66232853 TCTGCAGTTCAGACCGAAGCTGG - Intronic
1084361838 11:68673790-68673812 TTGGAGGCTCAGGCCTCAGCTGG - Intergenic
1084436967 11:69148622-69148644 TGTGTACCTCAGCCCTCAGCGGG + Intergenic
1084691829 11:70732056-70732078 TCTGAAGCCAAGACTTGAGCAGG - Intronic
1085923043 11:80981737-80981759 TATAAATCCCAGACCTCAGCTGG + Intergenic
1086432691 11:86750590-86750612 ACTGAAGCTCAGACCTCATTTGG - Intergenic
1086439713 11:86815952-86815974 TCTGAAGCAAAGACCTGATCAGG + Intronic
1088595013 11:111434973-111434995 TCTAAAGTTCAGACCTCACCTGG + Intronic
1088598514 11:111456766-111456788 TCTGAAGCCCAGAGCTGAGTTGG - Intronic
1089169867 11:116504499-116504521 TCTGAAACCCAGATCTCAGCGGG + Intergenic
1089629911 11:119778095-119778117 TGTGCAGCTCAGCCTTCAGCAGG + Intergenic
1090763722 11:129858759-129858781 CCTTAAGATCAGACCACAGCAGG - Exonic
1091536885 12:1419008-1419030 TCAGAAACGAAGACCTCAGCCGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1098408917 12:70158153-70158175 TCTGAAGCCCATACATCAGTAGG - Intergenic
1100535289 12:95503268-95503290 CCTGAAGTTCACACCTCAGGTGG - Intronic
1102111069 12:110366194-110366216 TCTGAAGGACAGACCCCTGCTGG + Intergenic
1102546977 12:113664374-113664396 TCTTCTGCTCAGACCTCACCAGG - Intergenic
1105410547 13:20168035-20168057 GCTGAAGGTGAGGCCTCAGCTGG - Intergenic
1108697317 13:52913860-52913882 TCTGTGGCTCTCACCTCAGCTGG + Intergenic
1109006671 13:56886183-56886205 TATAAACCCCAGACCTCAGCTGG + Intergenic
1109507001 13:63315075-63315097 TCAGAAGCTCAGAATTCAGAAGG - Intergenic
1110229496 13:73153490-73153512 TCTGAAGCTCAGAACAATGCAGG - Intergenic
1111117328 13:83796565-83796587 TATAAACCCCAGACCTCAGCTGG - Intergenic
1112895654 13:104296844-104296866 TCATCAGCTCAAACCTCAGCAGG + Intergenic
1114345426 14:21789637-21789659 TATAAACCTCAGACGTCAGCTGG + Intergenic
1115347497 14:32358928-32358950 TCTGCACCTGGGACCTCAGCAGG - Intronic
1116035909 14:39626923-39626945 TATAAACCCCAGACCTCAGCTGG + Intergenic
1116792629 14:49356305-49356327 TCTGAAGCTCAGATTTTAACTGG + Intergenic
1117066926 14:52020276-52020298 TCTGAAGCTGACACCTCACTGGG - Intronic
1119886654 14:78149225-78149247 TCTGTAGCTCAGAGCTCAAAGGG - Intergenic
1119913294 14:78371196-78371218 TATAAACCCCAGACCTCAGCTGG + Intronic
1121717331 14:96085498-96085520 TCTGCTGCTCAGACTTCAGGTGG - Intronic
1122751594 14:103937970-103937992 TTTGGAGCTCAGAGCTCAGTTGG + Intronic
1124215751 15:27806145-27806167 TCTGATGCTCCGCCCTCCGCGGG + Intronic
1124243492 15:28051077-28051099 TCTGGAGCTGGGACCTCTGCAGG + Intronic
1124692192 15:31833206-31833228 TGTGGAGCTCAGCCCTCTGCTGG - Intronic
1125932953 15:43613044-43613066 TTTGCAGCTCAGCCCTCACCAGG - Exonic
1125946052 15:43712506-43712528 TTTGCAGCTCAGCCCTCACCAGG - Intergenic
1126187099 15:45841156-45841178 TATAAACCCCAGACCTCAGCTGG + Intergenic
1126577138 15:50208297-50208319 TCTGAACCACTGACCTGAGCAGG - Intronic
1128204830 15:65841721-65841743 ACTTGAGCTCAGACCCCAGCAGG - Intronic
1128979556 15:72176294-72176316 GCTGAAGCACAAATCTCAGCCGG + Intronic
1131430509 15:92384590-92384612 CCCGCAGCTCAGACCACAGCTGG - Intergenic
1131961031 15:97790646-97790668 TCTGAACCTAAGTCCTCAGCAGG - Intergenic
1134515628 16:14884613-14884635 TCTCAACCTCAACCCTCAGCAGG - Intronic
1134703301 16:16283257-16283279 TCTCAACCTCAACCCTCAGCAGG - Intronic
1134964242 16:18428857-18428879 TCTCAACCTCAACCCTCAGCAGG + Intronic
1134968529 16:18511393-18511415 TCTCAACCTCAACCCTCAGCAGG + Intronic
1135200328 16:20431652-20431674 TCTGAAGGTCAAACTGCAGCCGG + Intronic
1135218359 16:20591947-20591969 TCTGAAGGTCAAACTGCAGCCGG - Intergenic
1137718039 16:50610978-50611000 CCTGGTCCTCAGACCTCAGCTGG - Intronic
1137797628 16:51235658-51235680 TCTCAAGCTCAACCATCAGCAGG + Intergenic
1138340843 16:56288241-56288263 ACTGCTGCTCAGAGCTCAGCTGG + Intronic
1140533476 16:75687649-75687671 TCTGAAGATGAGACTTCAACTGG - Intronic
1140533566 16:75688689-75688711 TCTGAAGATAAGACTTCAACTGG - Intronic
1140933733 16:79651813-79651835 TCAGAAGCTCACACCCCAGATGG - Intergenic
1141131730 16:81442177-81442199 TCTGAGGTTCAAACCTCGGCTGG + Intergenic
1141591878 16:85074635-85074657 TCTGAAGGCCAGACCTCAGAGGG - Intronic
1142425791 16:90001613-90001635 CCTGAAGCTCAGAGCCCAGAAGG - Intergenic
1143008543 17:3852887-3852909 TCTGAACCTCAGATCACAGCTGG + Intergenic
1143640946 17:8197057-8197079 ACTAAAGCTCTGACCTCGGCTGG - Intergenic
1144177572 17:12721737-12721759 TCTGAAGATCAGTCCTGAGTTGG + Intronic
1146503929 17:33388277-33388299 GCTGAAGTTAAGACATCAGCAGG - Intronic
1147350034 17:39835192-39835214 TCTGCATCCCAGACTTCAGCTGG + Intronic
1148187905 17:45657789-45657811 GCTGTAGCTCAGGCCTCAGGAGG + Intergenic
1151961368 17:77407683-77407705 CATAAAGCTCAGACCTCACCAGG - Intronic
1152827239 17:82474836-82474858 TCTGGAGCTGAGATCACAGCAGG - Intronic
1153772827 18:8429214-8429236 TCTGGAGCTCTGCCCTCTGCAGG - Intergenic
1162208770 19:9075527-9075549 TTTAAAGCTCAGGCCTGAGCTGG + Intergenic
1162878555 19:13639258-13639280 ACTGCAGCTCAGACCTCTCCAGG + Intergenic
1164128967 19:22344649-22344671 TCTGAAGCTGAGACCCAGGCAGG - Intergenic
1164937159 19:32223864-32223886 CCTGAAGCTCAGCCCTAGGCAGG - Intergenic
1165787518 19:38470804-38470826 TCCAAAACTCAGACCTCAACTGG - Intronic
1165815555 19:38639933-38639955 CCTGGGGCCCAGACCTCAGCAGG + Intergenic
1167471915 19:49680191-49680213 TCTCTAGCTCAGCCCACAGCTGG - Intronic
925048173 2:790138-790160 TCTGAAGGTGAGGCCTCACCAGG - Intergenic
925069659 2:956338-956360 TCTGCAGCTCAGTCCGGAGCAGG + Intronic
925574558 2:5348045-5348067 TCTGAAGTTCTGAGGTCAGCTGG + Intergenic
926385404 2:12330945-12330967 TCTGCAGCTCAGATGTCACCTGG - Intergenic
926962735 2:18376710-18376732 TCTGAAGCTCAGAAGTCAGATGG + Intergenic
927709277 2:25314939-25314961 CCTGCAGCTCAGGCCACAGCTGG + Intronic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
929535605 2:42782287-42782309 TCTGAAGTTCACACATCAGTAGG - Intronic
930495072 2:52131122-52131144 TCTGAAGTTCACACATCAGAAGG - Intergenic
931137803 2:59423724-59423746 TCTGTAGCTCAGACCACATCCGG - Intergenic
932593100 2:73078880-73078902 TATGAAGCTGTGACCTCACCAGG - Intronic
933571515 2:84019069-84019091 TCTGAAGCTCACACCTCTTAGGG + Intergenic
933828514 2:86186629-86186651 GCTGCAGCTGACACCTCAGCAGG - Intronic
934972020 2:98771440-98771462 GCTGCAGCTCAGAGCACAGCAGG + Intergenic
935857305 2:107288957-107288979 CATGCAGCTCAGACCACAGCGGG - Intergenic
938070636 2:128306513-128306535 TCTAAAGCTCATAACTCAGAGGG + Intronic
940919423 2:159290467-159290489 TCCAAAGCTCACCCCTCAGCCGG - Intergenic
941427617 2:165368305-165368327 TATAAAGCCCAGAACTCAGCAGG - Intronic
943393957 2:187308696-187308718 TCTGTAGCCCAGACCTCAGCAGG + Intergenic
943586509 2:189747307-189747329 TCTCACTCTCTGACCTCAGCTGG - Intronic
944364453 2:198900493-198900515 TCTGAATCTCAGCCCTGAGTAGG + Intergenic
944945453 2:204678703-204678725 TATAAACCTCAGAGCTCAGCTGG - Intronic
948136361 2:235639271-235639293 TCTCAAGCTCAGAGCTGAGCTGG + Intronic
948452199 2:238082757-238082779 TTTGAAGCACAGTCCTCAGCTGG + Intronic
948889077 2:240898053-240898075 TCAGAGGCTCTGACCTCAGCTGG - Intergenic
949051055 2:241897488-241897510 TCTGAGACTCAGGCCTCAGGTGG + Intronic
1170715272 20:18825539-18825561 TCTAAAGCCAAAACCTCAGCAGG - Intronic
1170827256 20:19807493-19807515 TCTTTATCTCAGACCTGAGCTGG + Intergenic
1171072932 20:22092722-22092744 TATAAACCTGAGACCTCAGCAGG - Intergenic
1173250886 20:41363707-41363729 TCTGAGGCTCAGGCTCCAGCTGG + Exonic
1176271817 20:64239345-64239367 GGTGAAGCTAAGACCACAGCAGG + Intronic
1177218477 21:18159775-18159797 TCTGATTCTCTGACCACAGCTGG - Intronic
1178178286 21:30129893-30129915 TATAAACCCCAGACCTCAGCTGG - Intergenic
1180162446 21:46004269-46004291 TCTGAGGCTCAGCCCTGAGCTGG + Exonic
1180162457 21:46004311-46004333 TCTGGGGCTCAGCCCTGAGCTGG + Exonic
1181853268 22:25765175-25765197 TCTGAGCCTCAGCCCACAGCAGG + Intronic
1183617784 22:38955621-38955643 TCTGCAGCCCAGACATGAGCGGG - Intronic
1184095668 22:42314955-42314977 TCTTCAGCTCACACCACAGCAGG + Intronic
1184248437 22:43247296-43247318 ACTGAAGCTCAGATGTGAGCTGG + Intronic
1184343705 22:43900388-43900410 TCTGGAGCTGAGTCCTCAGAAGG - Intergenic
1185023760 22:48396098-48396120 TCTGAGCCTGAGTCCTCAGCTGG - Intergenic
1185168388 22:49276502-49276524 TCTGATGCACACACTTCAGCTGG - Intergenic
1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG + Intronic
1185409053 22:50673289-50673311 TCTCAAGCTCTGCCCTCAGGGGG + Intergenic
950110268 3:10414227-10414249 TCTGAATCGCAGAACTCAGAAGG - Intronic
950157098 3:10729747-10729769 GCTGAAGCTCAGTTCTCAGAAGG + Intergenic
951651394 3:24955335-24955357 TATAAACCCCAGACCTCAGCTGG - Intergenic
953069172 3:39502625-39502647 GCTGACGCTCAGACCTCGGAGGG - Exonic
953069179 3:39502655-39502677 GCTGACGCTCAGACCTCGGAGGG - Exonic
953069186 3:39502685-39502707 GCTGACGCTCAGACCTCGGAGGG - Exonic
953069193 3:39502715-39502737 GCTGACGCTCAGACCTCGGAGGG - Exonic
954526413 3:51275685-51275707 TCTGAGGCTCAGAGCTCTGGTGG - Intronic
955075911 3:55613182-55613204 TCTGTAGCTTAGTTCTCAGCTGG - Intronic
955450131 3:59057548-59057570 TCTGAAGCCCAGACCCCAATTGG + Intergenic
956123609 3:65990823-65990845 TTTGAATCTCAGATCTCAGCTGG + Intronic
959565047 3:107825543-107825565 TCTCACCCACAGACCTCAGCTGG - Intergenic
959946829 3:112133993-112134015 TATAAACCCCAGACCTCAGCTGG + Intergenic
959970251 3:112401004-112401026 TCTGAAGTTCATACATCAGTAGG + Intergenic
961313440 3:126018098-126018120 TCAGCTGCTCACACCTCAGCGGG + Intronic
961646553 3:128395732-128395754 ACTGAGGCTCAGCCCTCTGCTGG - Intronic
962005324 3:131343721-131343743 TCTGGAGCTCTGGCCTAAGCTGG + Intronic
962126617 3:132626079-132626101 TGTGAAGCTTAGACTTTAGCAGG - Intronic
962712788 3:138101711-138101733 TCTGCATCTCAGACTCCAGCCGG + Intronic
965114384 3:164469244-164469266 TCTGAAGTTCATACATCAGTAGG - Intergenic
966116516 3:176469827-176469849 TCTGCAGGTCAGACCCCGGCAGG - Intergenic
967640229 3:191853790-191853812 TCTGACGGTCAGACCACATCTGG - Intergenic
967982514 3:195074273-195074295 GCTGAATCTCAGACCTCAAATGG - Intronic
969727774 4:8934009-8934031 TCTGAAGTTCATACATCAGCAGG - Intergenic
970316668 4:14834619-14834641 TCAGAGGCTCTGACATCAGCTGG - Intergenic
971427351 4:26529685-26529707 TATAAACCCCAGACCTCAGCTGG - Intergenic
972602590 4:40586225-40586247 TCTTTACCTCAAACCTCAGCAGG - Intronic
974752290 4:66156409-66156431 TATAAACCCCAGACCTCAGCTGG + Intergenic
975051633 4:69872542-69872564 TCTGAAGTTCATACATCAGTAGG - Intergenic
975164835 4:71166738-71166760 TCTGAAGCTCAGACATAAATTGG - Intergenic
975728642 4:77316668-77316690 TCTGAAGCTCAGATTTCACTTGG - Intronic
976802365 4:89006946-89006968 TATGAACCCCAGACCTCAGCTGG - Intronic
977354840 4:95932724-95932746 TCTGAAGTTCATACATCAGTAGG - Intergenic
979649520 4:123114300-123114322 TCTGAAGATGAGGCCTCACCAGG + Intronic
982934708 4:161457975-161457997 TTTGAAGCCCATACCTCAGCTGG + Intronic
985134473 4:186771795-186771817 TCTAAAGCTGAGGCATCAGCAGG - Intergenic
987304137 5:16621892-16621914 TCTGCAGCTCAGAGACCAGCAGG + Intergenic
987926731 5:24351278-24351300 TATAAACCCCAGACCTCAGCTGG - Intergenic
991255782 5:64612555-64612577 TCTGAAGCTCAGCTTTCAGTAGG - Intergenic
991461434 5:66863451-66863473 TCTGGAGGTCAGACCGAAGCCGG - Intronic
992650500 5:78855037-78855059 TCAGCAGCTCAGACTTCAGGAGG + Intronic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
994683936 5:102925426-102925448 TGTGATGCCAAGACCTCAGCTGG + Intronic
995263732 5:110135539-110135561 GCTGAAGCTGAGCCCACAGCTGG + Intergenic
997310428 5:132875265-132875287 TCAGAAAATGAGACCTCAGCTGG + Intergenic
998429600 5:142059676-142059698 ACTCAAGGTCAGACCTCATCAGG + Intergenic
998569745 5:143246492-143246514 TCTGATGCTGAGGCCTCTGCTGG - Intergenic
999076732 5:148803522-148803544 TCTGATGCTTACACCTCAGGAGG + Intergenic
999076759 5:148803782-148803804 TCTGATGCTTACACCTCAGGAGG + Intergenic
1000794595 5:165649186-165649208 GCAGAGGCTCAGATCTCAGCAGG - Intergenic
1000910731 5:167019013-167019035 TCTGAAGACCAGACCTGAGAAGG - Intergenic
1002087313 5:176784348-176784370 TCAGGAGGTCAGACCTCAGATGG - Intergenic
1006824982 6:36928288-36928310 TCTGAAACTCAGACCTCGGCTGG - Intronic
1009491609 6:64299446-64299468 TCTGTGGGTCAGACCCCAGCAGG + Intronic
1009570228 6:65374939-65374961 ACTGAAGCTGCGACCACAGCCGG - Intronic
1012064896 6:94537642-94537664 TCTGAAGCCATGACCTGAGCTGG + Intergenic
1013311090 6:108894505-108894527 CCAGTAGCTCAGACCTGAGCAGG + Exonic
1014455722 6:121632500-121632522 TCTGAAGTCCATACATCAGCAGG + Intergenic
1017386113 6:153885637-153885659 TCTGAAGTCCATACATCAGCAGG + Intergenic
1017740428 6:157401516-157401538 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740434 6:157401622-157401644 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740436 6:157401658-157401680 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740446 6:157401764-157401786 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740448 6:157401800-157401822 ACTGAAGCTGTGATCTCAGCAGG - Intronic
1017740452 6:157401867-157401889 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740470 6:157402172-157402194 TCTGCAGTTATGACCTCAGCAGG - Intronic
1017740476 6:157402275-157402297 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740480 6:157402347-157402369 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017740488 6:157402455-157402477 ACTGCAGCTGAGACCTCAGCAGG - Intronic
1017816074 6:158017632-158017654 TCTGAAACTCCGACCTCAGGTGG + Intronic
1018067851 6:160136158-160136180 TCTGACGTTCAGCCCTGAGCGGG - Intronic
1018179876 6:161213667-161213689 TCTGAAGCCCATACATCAGTAGG - Intronic
1019420467 7:948321-948343 TCAGAAGCTCAGGCCTCGGTGGG - Intronic
1019879885 7:3849320-3849342 AAAGGAGCTCAGACCTCAGCAGG - Intronic
1021890363 7:25180605-25180627 TCGGATGCTCCGACCTCACCAGG - Intergenic
1022621873 7:31992490-31992512 TGTGATGCTGAGACCTCAGTGGG + Intronic
1024657595 7:51464913-51464935 TCTGCAGCTCTGAGCTCTGCTGG - Intergenic
1033532666 7:142281084-142281106 TCTGAATCACTGACCTCAGGAGG - Intergenic
1034216806 7:149413908-149413930 TCTCAATCTCACACCTCAGGAGG + Intergenic
1036153213 8:6317878-6317900 TCTGAAGATGAGGCCTCAGAGGG + Intergenic
1036802989 8:11806721-11806743 TCTGGAGCTCAGTCCAGAGCGGG + Intronic
1037039420 8:14211951-14211973 TCTGAATCTCAGTCCTGAGGTGG + Intronic
1038219392 8:25593126-25593148 TCTGAAGCTCAAATCTTAGAGGG + Intergenic
1038347922 8:26748921-26748943 TCTGAAGCTGTCCCCTCAGCAGG + Intronic
1038431635 8:27505020-27505042 TCTTCAGCTCACACATCAGCTGG - Exonic
1038444272 8:27592746-27592768 TGGGACGCTCAGAGCTCAGCTGG - Intergenic
1041696850 8:60744915-60744937 TCTGAAGCTTCGTCCTAAGCTGG + Intronic
1041781172 8:61579419-61579441 TCTGCATCCCAGACTTCAGCCGG - Intronic
1045189427 8:99868339-99868361 TCTGAGGCACAGGCTTCAGCAGG + Exonic
1045358874 8:101413792-101413814 TCTCCAGCTCAGACCTCTCCTGG - Intergenic
1045597627 8:103674017-103674039 TCTGAAGTTCAGACTTCCACAGG + Intronic
1046396806 8:113650973-113650995 TATAAACCCCAGACCTCAGCTGG + Intergenic
1047862998 8:128989575-128989597 TCTGAAGTTAAGATGTCAGCAGG + Intergenic
1048071669 8:131027969-131027991 TGTGAAGCTCACAGCCCAGCTGG + Intronic
1049204628 8:141358002-141358024 CCTGAGGCCCAGAACTCAGCTGG + Intronic
1049599747 8:143501917-143501939 GCTGAAGCCCTGACCCCAGCGGG + Intronic
1050332245 9:4557068-4557090 TCCGAAACTTGGACCTCAGCAGG - Intronic
1050379235 9:5009185-5009207 TCCGAGGCTCAGACATCAGCAGG + Intronic
1052433396 9:28395786-28395808 GCCATAGCTCAGACCTCAGCAGG + Intronic
1053009621 9:34625644-34625666 TGCCAAGCTCAGGCCTCAGCAGG + Intronic
1053058938 9:35013543-35013565 TCTGAAGTTCATACATCAGTAGG + Intergenic
1057859904 9:98632756-98632778 TCAGAAATTCAGACCACAGCAGG - Intronic
1057940216 9:99275509-99275531 TCTGAGGCTAATACCTCAGATGG + Intergenic
1058149138 9:101444756-101444778 TGTATAGCTCAGATCTCAGCTGG + Intergenic
1058773328 9:108260165-108260187 TATGGAGCTAAGACCTCAGCAGG + Intergenic
1059753217 9:117268512-117268534 TCAGAAGCACAGACCTTAGACGG - Intronic
1059796526 9:117703593-117703615 ACTGAAGTTCAGATCTCAGCTGG - Intergenic
1186458427 X:9729138-9729160 TCTGGAGCCCAGACACCAGCTGG + Intronic
1186535591 X:10343894-10343916 TCTGCAGCTCAGACAACAACAGG + Intergenic
1188496160 X:30785095-30785117 TCTGAACCTAAGACCTCTTCAGG + Intergenic
1191612679 X:63133905-63133927 TCTGAAGTTCATACATCAGTAGG + Intergenic
1191623618 X:63245021-63245043 TCTGAAGTTCATACATCAGTAGG - Intergenic
1194665000 X:96667704-96667726 TCTGAAGTCCAGGCATCAGCAGG + Intergenic
1195287586 X:103400392-103400414 TCTGAAGTGCAGACCTGAGAGGG + Intergenic
1196045061 X:111248369-111248391 TCTGAAGTTCAGACCTTCACTGG + Intronic
1199938656 X:152602352-152602374 TCTTCAGCTCCCACCTCAGCGGG - Intergenic